diff --git a/.gitignore b/.gitignore index 2a5aa70..659b74b 100644 --- a/.gitignore +++ b/.gitignore @@ -5,3 +5,4 @@ /.travis.yml~ /.idea __pycache__ +.DS_Store diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld index d7ca376..67cbd5d 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld @@ -1,32 +1,5 @@ { "@graph": [ - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1", - "sbol:start": "1", - "sbol:orientation": { - "@id": "SO:0001030" - }, - "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" - }, - "sbol:end": "54", - "sbol:displayId": "Range1", - "@type": "sbol:Range" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1", - "sbol:name": "Sequence1", - "sbol:hasNamespace": { - "@id": "https://synbiohub.org/public/igem" - }, - "sbol:encoding": { - "@id": "EDAM:format_1207" - }, - "sbol:elements": "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa", - "sbol:displayId": "BBa_F2620_Sequence1", - "sbol:description": "BBa_F2620 sequence", - "@type": "sbol:Sequence" - }, { "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5", "sbol:orientation": { @@ -74,7 +47,7 @@ "@type": "sbol:Range" }, { - "@id": "https://synbiohub.org/public/igem/BBa_C0062_Sequence1", + "@id": "https://synbiohub.org/public/igem/BBa_B0034_Sequence1", "sbol:name": "Sequence1", "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" @@ -82,13 +55,26 @@ "sbol:encoding": { "@id": "EDAM:format_1207" }, - "sbol:elements": "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac", - "sbol:displayId": "BBa_C0062_Sequence1", - "sbol:description": "BBa_C0062 sequence", + "sbol:elements": "aaagaggagaaa", + "sbol:displayId": "BBa_B0034_Sequence1", + "sbol:description": "BBa_B0034 sequence", "@type": "sbol:Sequence" }, { - "@id": "https://synbiohub.org/public/igem/BBa_B0010_Sequence1", + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1", + "sbol:start": "969", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + }, + "sbol:end": "1023", + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1", "sbol:name": "Sequence1", "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" @@ -96,30 +82,11 @@ "sbol:encoding": { "@id": "EDAM:format_1207" }, - "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", - "sbol:displayId": "BBa_B0010_Sequence1", - "sbol:description": "BBa_B0010 sequence", + "sbol:elements": "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa", + "sbol:displayId": "BBa_F2620_Sequence1", + "sbol:description": "BBa_F2620 sequence", "@type": "sbol:Sequence" }, - { - "@id": "https://synbiohub.org/public/igem/BBa_C0062_protein", - "sbol:type": { - "@id": "SBO:0000252" - }, - "sbol:role": { - "@id": "GO:0003700" - }, - "sbol:name": "LuxR", - "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1" - }, - "sbol:hasNamespace": { - "@id": "https://synbiohub.org/public/igem" - }, - "sbol:displayId": "BBa_C0062_protein", - "sbol:description": "LuxR protein", - "@type": "sbol:Component" - }, { "@id": "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1", "sbol:name": "Sequence1", @@ -135,58 +102,85 @@ "@type": "sbol:Sequence" }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1", - "sbol:type": { - "@id": "SBO:0000589" + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2", + "sbol:orientation": { + "@id": "SO:0001030" }, - "sbol:hasParticipation": [ - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2" - } - ], - "sbol:displayId": "Interaction1", - "@type": "sbol:Interaction" + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_B0012" + }, + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1", + "@id": "https://synbiohub.org/public/igem/BBa_B0012", + "sbol:type": { + "@id": "SBO:0000251" + }, "sbol:role": { - "@id": "SBO:0000645" + "@id": "SO:0000141" }, - "sbol:participant": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" + "sbol:name": "BBa_B0012", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_B0012_Sequence1" }, - "sbol:displayId": "Participation1", - "@type": "sbol:Participation" + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "BBa_B0012", + "sbol:description": "Double terminator consisting of BBa_B0010 and BBa_B0012", + "@type": "sbol:Component" }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2", - "sbol:role": { - "@id": "SBO:0000011" + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1", + "sbol:start": "81", + "sbol:orientation": { + "@id": "SO:0001030" }, - "sbol:participant": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" }, - "sbol:displayId": "Participation2", - "@type": "sbol:Participation" + "sbol:end": "121", + "sbol:displayId": "Range1", + "@type": "sbol:Range" }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1", - "sbol:start": "969", + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1", + "sbol:start": "55", "sbol:orientation": { "@id": "SO:0001030" }, "sbol:hasSequence": { "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" }, - "sbol:end": "1023", + "sbol:end": "66", "sbol:displayId": "Range1", "@type": "sbol:Range" }, { - "@id": "https://synbiohub.org/public/igem/BBa_B0012_Sequence1", + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_C0062_protein" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_C0062_Sequence1", "sbol:name": "Sequence1", "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" @@ -194,51 +188,27 @@ "sbol:encoding": { "@id": "EDAM:format_1207" }, - "sbol:elements": "tcacactggctcaccttcgggtgggcctttctgcgtttata", - "sbol:displayId": "BBa_B0012_Sequence1", - "sbol:description": "BBa_B0012 sequence", + "sbol:elements": "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac", + "sbol:displayId": "BBa_C0062_Sequence1", + "sbol:description": "BBa_C0062 sequence", "@type": "sbol:Sequence" }, { - "@id": "https://synbiohub.org/public/igem/BBa_B0012", - "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:role": { - "@id": "SO:0000141" - }, - "sbol:name": "BBa_B0012", - "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/BBa_B0012_Sequence1" - }, + "@id": "https://synbiohub.org/public/igem/BBa_B0012_Sequence1", + "sbol:name": "Sequence1", "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" }, - "sbol:displayId": "BBa_B0012", - "sbol:description": "Double terminator consisting of BBa_B0010 and BBa_B0012", - "@type": "sbol:Component" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_R0040", - "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:role": { - "@id": "SO:0000167" - }, - "sbol:name": "pTetR", - "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" - }, - "sbol:hasNamespace": { - "@id": "https://synbiohub.org/public/igem" + "sbol:encoding": { + "@id": "EDAM:format_1207" }, - "sbol:displayId": "BBa_R0040", - "sbol:description": "TetR repressible promoter", - "@type": "sbol:Component" + "sbol:elements": "tcacactggctcaccttcgggtgggcctttctgcgtttata", + "sbol:displayId": "BBa_B0012_Sequence1", + "sbol:description": "BBa_B0012 sequence", + "@type": "sbol:Sequence" }, { - "@id": "https://synbiohub.org/public/igem/BBa_R0040_Sequence1", + "@id": "https://synbiohub.org/public/igem/BBa_B0015_Sequence1", "sbol:name": "Sequence1", "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" @@ -246,240 +216,352 @@ "sbol:encoding": { "@id": "EDAM:format_1207" }, - "sbol:elements": "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac", - "sbol:displayId": "BBa_R0040_Sequence1", - "sbol:description": "BBa_R0040 sequence", + "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata", + "sbol:displayId": "BBa_B0015_Sequence1", + "sbol:description": "BBa_B0015 sequence", "@type": "sbol:Sequence" }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4", + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7", "sbol:orientation": { "@id": "SO:0001030" }, "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/BBa_B0034" + "@id": "https://synbiohub.org/public/igem/BBa_R0062" }, "sbol:hasLocation": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1" + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1" }, - "sbol:displayId": "SubComponent4", + "sbol:displayId": "SubComponent7", "@type": "sbol:SubComponent" }, { - "@id": "https://synbiohub.org/public/igem/BBa_B0034", + "@id": "https://synbiohub.org/public/igem/BBa_R0062", "sbol:type": { "@id": "SBO:0000251" }, "sbol:role": { - "@id": "SO:0000139" + "@id": "SO:0000167" }, - "sbol:name": "BBa_B0034", + "sbol:name": "lux pR", "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/BBa_B0034_Sequence1" + "@id": "https://synbiohub.org/public/igem/BBa_R0062_Sequence1" }, "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" }, - "sbol:displayId": "BBa_B0034", - "sbol:description": "RBS based on Elowitz repressilator", + "sbol:displayId": "BBa_R0062", + "sbol:description": "Promoter (luxR & HSL regulated -- lux pR)", "@type": "sbol:Component" }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1", - "sbol:start": "55", - "sbol:orientation": { - "@id": "SO:0001030" + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2", + "sbol:role": { + "@id": "SBO:0000459" }, - "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" }, - "sbol:end": "66", - "sbol:displayId": "Range1", - "@type": "sbol:Range" + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3", - "sbol:orientation": { - "@id": "SO:0001030" - }, + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2", "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/BBa_R0040" - }, - "sbol:hasLocation": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1" + "@id": "https://synbiohub.org/public/igem/TetR_protein" }, - "sbol:displayId": "SubComponent3", + "sbol:displayId": "SubComponent2", "@type": "sbol:SubComponent" }, { - "@id": "https://synbiohub.org/public/igem/BBa_B0015_Sequence1", + "@id": "https://synbiohub.org/public/igem/TetR_protein", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:name": "TetR", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/TetR_protein_Sequence1" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "TetR_protein", + "sbol:description": "TetR protein", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/TetR_protein_Sequence1", "sbol:name": "Sequence1", "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" }, "sbol:encoding": { - "@id": "EDAM:format_1207" + "@id": "EDAM:format_1208" }, - "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata", - "sbol:displayId": "BBa_B0015_Sequence1", - "sbol:description": "BBa_B0015 sequence", + "sbol:elements": "NNNNNNNNNNN", + "sbol:displayId": "TetR_protein_Sequence1", + "sbol:description": "TetR_protein sequence", "@type": "sbol:Sequence" }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1", - "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/BBa_C0062_protein" + "@id": "https://synbiohub.org/public/igem/BBa_F2620", + "sbol:hasFeature": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4" + } + ], + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" }, - "sbol:displayId": "SubComponent1", - "@type": "sbol:SubComponent" + "sbol:name": "BBa_F2620", + "sbol:description": "PoPS Receiver", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:hasInteraction": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1" + } + ], + "sbol:role": { + "@id": "SO:0000704" + }, + "@type": "sbol:Component", + "sbol:displayId": "BBa_F2620", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + } }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2", - "sbol:role": { - "@id": "SBO:0000459" + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3", + "sbol:orientation": { + "@id": "SO:0001030" }, - "sbol:participant": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040" }, - "sbol:displayId": "Participation2", - "@type": "sbol:Participation" + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2", - "sbol:role": { - "@id": "SBO:0000459" - }, - "sbol:participant": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3", + "sbol:type": { + "@id": "SBO:0000170" }, - "sbol:displayId": "Participation2", - "@type": "sbol:Participation" + "sbol:hasParticipation": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2" + } + ], + "sbol:displayId": "Interaction3", + "@type": "sbol:Interaction" }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2", + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6", + "sbol:orientation": { + "@id": "SO:0001030" + }, "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/TetR_protein" + "@id": "https://synbiohub.org/public/igem/BBa_B0015" }, - "sbol:displayId": "SubComponent2", + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1" + }, + "sbol:displayId": "SubComponent6", "@type": "sbol:SubComponent" }, { - "@id": "https://synbiohub.org/public/igem/TetR_protein_Sequence1", - "sbol:name": "Sequence1", - "sbol:hasNamespace": { - "@id": "https://synbiohub.org/public/igem" - }, - "sbol:encoding": { - "@id": "EDAM:format_1208" + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2", + "sbol:type": { + "@id": "SBO:0000170" }, - "sbol:elements": "NNNNNNNNNNN", - "sbol:displayId": "TetR_protein_Sequence1", - "sbol:description": "TetR_protein sequence", - "@type": "sbol:Sequence" + "sbol:hasParticipation": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2" + } + ], + "sbol:displayId": "Interaction2", + "@type": "sbol:Interaction" }, { - "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2", + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4", "sbol:orientation": { "@id": "SO:0001030" }, "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/BBa_B0012" + "@id": "https://synbiohub.org/public/igem/BBa_B0034" }, "sbol:hasLocation": { - "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1" + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1" }, - "sbol:displayId": "SubComponent2", + "sbol:displayId": "SubComponent4", "@type": "sbol:SubComponent" }, { - "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1", - "sbol:start": "81", + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:hasParticipation": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2" + } + ], + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1", + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1", + "sbol:start": "848", "sbol:orientation": { "@id": "SO:0001030" }, "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" + "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" }, - "sbol:end": "121", + "sbol:end": "968", "sbol:displayId": "Range1", "@type": "sbol:Range" }, { - "@id": "https://synbiohub.org/public/igem/BBa_B0010", - "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:role": { - "@id": "SO:0000141" + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1", + "sbol:start": "1", + "sbol:orientation": { + "@id": "SO:0001030" }, - "sbol:name": "BBa_B0010", "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/BBa_B0010_Sequence1" + "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" }, + "sbol:end": "54", + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_Sequence1", + "sbol:name": "Sequence1", "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" }, - "sbol:displayId": "BBa_B0010", - "sbol:description": "Transcriptional terminator consisting of a 64 bp stem-loop", - "@type": "sbol:Component" + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac", + "sbol:displayId": "BBa_R0040_Sequence1", + "sbol:description": "BBa_R0040 sequence", + "@type": "sbol:Sequence" }, { - "@id": "https://synbiohub.org/public/igem/TetR_protein", + "@id": "https://synbiohub.org/public/igem/BBa_B0034", "sbol:type": { - "@id": "SBO:0000252" + "@id": "SBO:0000251" }, "sbol:role": { - "@id": "GO:0003700" + "@id": "SO:0000139" }, - "sbol:name": "TetR", + "sbol:name": "BBa_B0034", "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/TetR_protein_Sequence1" + "@id": "https://synbiohub.org/public/igem/BBa_B0034_Sequence1" }, "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" }, - "sbol:displayId": "TetR_protein", - "sbol:description": "TetR protein", + "sbol:displayId": "BBa_B0034", + "sbol:description": "RBS based on Elowitz repressilator", "@type": "sbol:Component" }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1", + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2", "sbol:role": { - "@id": "SBO:0000643" + "@id": "SBO:0000459" }, "sbol:participant": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" }, - "sbol:displayId": "Participation1", + "sbol:displayId": "Participation2", "@type": "sbol:Participation" }, { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7", + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1", "sbol:orientation": { "@id": "SO:0001030" }, "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/BBa_R0062" + "@id": "https://synbiohub.org/public/igem/BBa_B0010" }, "sbol:hasLocation": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1" + "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1" }, - "sbol:displayId": "SubComponent7", + "sbol:displayId": "SubComponent1", "@type": "sbol:SubComponent" }, { - "@id": "https://synbiohub.org/public/igem/BBa_B0034_Sequence1", - "sbol:name": "Sequence1", + "@id": "https://synbiohub.org/public/igem/BBa_B0010", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "BBa_B0010", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_B0010_Sequence1" + }, "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" }, - "sbol:encoding": { - "@id": "EDAM:format_1207" - }, - "sbol:elements": "aaagaggagaaa", - "sbol:displayId": "BBa_B0034_Sequence1", - "sbol:description": "BBa_B0034 sequence", - "@type": "sbol:Sequence" + "sbol:displayId": "BBa_B0010", + "sbol:description": "Transcriptional terminator consisting of a 64 bp stem-loop", + "@type": "sbol:Component" }, { "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1", @@ -494,6 +576,20 @@ "sbol:displayId": "Range1", "@type": "sbol:Range" }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0062_Sequence1", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa", + "sbol:displayId": "BBa_R0062_Sequence1", + "sbol:description": "BBa_R0062 sequence", + "@type": "sbol:Sequence" + }, { "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1", "sbol:role": { @@ -507,12 +603,13 @@ }, { "@id": "https://synbiohub.org/public/igem/BBa_B0015", + "sbol:name": "BBa_B0015", + "sbol:description": "Double terminator consisting of BBa_B0010 and BBa_B0012", "sbol:hasSequence": { "@id": "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" }, - "@type": "sbol:Component", - "sbol:type": { - "@id": "SBO:0000251" + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" }, "sbol:hasFeature": [ { @@ -522,32 +619,47 @@ "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1" } ], - "sbol:description": "Double terminator consisting of BBa_B0010 and BBa_B0012", - "sbol:hasNamespace": { - "@id": "https://synbiohub.org/public/igem" + "sbol:type": { + "@id": "SBO:0000251" }, + "sbol:displayId": "BBa_B0015", + "@type": "sbol:Component", "sbol:role": { "@id": "SO:0000141" - }, - "sbol:name": "BBa_B0015", - "sbol:displayId": "BBa_B0015" + } }, { - "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1", - "sbol:orientation": { - "@id": "SO:0001030" + "@id": "https://synbiohub.org/public/igem/BBa_C0062_protein", + "sbol:type": { + "@id": "SBO:0000252" }, - "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/BBa_B0010" + "sbol:role": { + "@id": "GO:0003700" }, - "sbol:hasLocation": { - "@id": "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1" + "sbol:name": "LuxR", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1" }, - "sbol:displayId": "SubComponent1", - "@type": "sbol:SubComponent" + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "BBa_C0062_protein", + "sbol:description": "LuxR protein", + "@type": "sbol:Component" }, { - "@id": "https://synbiohub.org/public/igem/BBa_R0062_Sequence1", + "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1", + "sbol:role": { + "@id": "SBO:0000643" + }, + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_B0010_Sequence1", "sbol:name": "Sequence1", "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" @@ -555,141 +667,29 @@ "sbol:encoding": { "@id": "EDAM:format_1207" }, - "sbol:elements": "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa", - "sbol:displayId": "BBa_R0062_Sequence1", - "sbol:description": "BBa_R0062 sequence", + "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", + "sbol:displayId": "BBa_B0010_Sequence1", + "sbol:description": "BBa_B0010 sequence", "@type": "sbol:Sequence" }, { - "@id": "https://synbiohub.org/public/igem/BBa_R0062", + "@id": "https://synbiohub.org/public/igem/BBa_R0040", "sbol:type": { "@id": "SBO:0000251" }, "sbol:role": { "@id": "SO:0000167" }, - "sbol:name": "lux pR", + "sbol:name": "pTetR", "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/BBa_R0062_Sequence1" + "@id": "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" }, "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" }, - "sbol:displayId": "BBa_R0062", - "sbol:description": "Promoter (luxR & HSL regulated -- lux pR)", + "sbol:displayId": "BBa_R0040", + "sbol:description": "TetR repressible promoter", "@type": "sbol:Component" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620", - "sbol:hasFeature": [ - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" - } - ], - "sbol:hasInteraction": [ - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction1" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3" - } - ], - "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" - }, - "sbol:displayId": "BBa_F2620", - "@type": "sbol:Component", - "sbol:role": { - "@id": "SO:0000704" - }, - "sbol:hasNamespace": { - "@id": "https://synbiohub.org/public/igem" - }, - "sbol:name": "BBa_F2620", - "sbol:description": "PoPS Receiver", - "sbol:type": { - "@id": "SBO:0000251" - } - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2", - "sbol:type": { - "@id": "SBO:0000170" - }, - "sbol:hasParticipation": [ - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2" - } - ], - "sbol:displayId": "Interaction2", - "@type": "sbol:Interaction" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6", - "sbol:orientation": { - "@id": "SO:0001030" - }, - "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/BBa_B0015" - }, - "sbol:hasLocation": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1" - }, - "sbol:displayId": "SubComponent6", - "@type": "sbol:SubComponent" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3", - "sbol:type": { - "@id": "SBO:0000170" - }, - "sbol:hasParticipation": [ - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2" - } - ], - "sbol:displayId": "Interaction3", - "@type": "sbol:Interaction" - }, - { - "@id": "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1", - "sbol:start": "848", - "sbol:orientation": { - "@id": "SO:0001030" - }, - "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" - }, - "sbol:end": "968", - "sbol:displayId": "Range1", - "@type": "sbol:Range" } ], "@context": { diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld_expanded b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld_expanded index 4d18d06..e204813 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld_expanded +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.jsonld_expanded @@ -1,841 +1 @@ -[ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0010", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000141" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "BBa_B0010" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0010_Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_B0010" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Transcriptional terminator consisting of a 64 bp stem-loop" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0010_Sequence1", - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1207" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_B0010_Sequence1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "BBa_B0010 sequence" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0012", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000141" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "BBa_B0012" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0012_Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_B0012" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Double terminator consisting of BBa_B0010 and BBa_B0012" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0012_Sequence1", - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1207" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "tcacactggctcaccttcgggtgggcctttctgcgtttata" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_B0012_Sequence1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "BBa_B0012 sequence" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015", - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Double terminator consisting of BBa_B0010 and BBa_B0012" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000141" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "BBa_B0015" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_B0015" - } ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0010" - } ], - "http://sbols.org/v3#hasLocation" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1", - "http://sbols.org/v3#start" : [ { - "@value" : "1" - } ], - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" - } ], - "http://sbols.org/v3#end" : [ { - "@value" : "80" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Range1" - } ], - "@type" : [ "http://sbols.org/v3#Range" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0012" - } ], - "http://sbols.org/v3#hasLocation" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1", - "http://sbols.org/v3#start" : [ { - "@value" : "81" - } ], - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" - } ], - "http://sbols.org/v3#end" : [ { - "@value" : "121" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Range1" - } ], - "@type" : [ "http://sbols.org/v3#Range" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1", - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1207" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_B0015_Sequence1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "BBa_B0015 sequence" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0034", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000139" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "BBa_B0034" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0034_Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_B0034" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "RBS based on Elowitz repressilator" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_B0034_Sequence1", - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1207" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "aaagaggagaaa" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_B0034_Sequence1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "BBa_B0034 sequence" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_C0062", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000316" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "luxR" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_C0062_Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_C0062" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "luxR repressor/activator, (no LVA?)" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_C0062_Sequence1", - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1207" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_C0062_Sequence1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "BBa_C0062 sequence" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_C0062_protein", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/GO:0003700" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "LuxR" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_C0062_protein" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "LuxR protein" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1", - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1208" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "NNNNNNNNNNN" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_C0062_protein_Sequence1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "BBa_C0062_protein sequence" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620", - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" - } ], - "http://sbols.org/v3#hasInteraction" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_F2620" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000704" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "BBa_F2620" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "PoPS Receiver" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000589" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction1" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000645" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000011" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000170" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction2" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000643" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000459" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000170" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1" - }, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction3" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000643" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000459" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_C0062_protein" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/TetR_protein" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_R0040" - } ], - "http://sbols.org/v3#hasLocation" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent3" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1", - "http://sbols.org/v3#start" : [ { - "@value" : "1" - } ], - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" - } ], - "http://sbols.org/v3#end" : [ { - "@value" : "54" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Range1" - } ], - "@type" : [ "http://sbols.org/v3#Range" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0034" - } ], - "http://sbols.org/v3#hasLocation" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent4" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1", - "http://sbols.org/v3#start" : [ { - "@value" : "55" - } ], - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" - } ], - "http://sbols.org/v3#end" : [ { - "@value" : "66" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Range1" - } ], - "@type" : [ "http://sbols.org/v3#Range" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_C0062" - } ], - "http://sbols.org/v3#hasLocation" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5/Range1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent5" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5/Range1", - "http://sbols.org/v3#start" : [ { - "@value" : "67" - } ], - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" - } ], - "http://sbols.org/v3#end" : [ { - "@value" : "847" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Range1" - } ], - "@type" : [ "http://sbols.org/v3#Range" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_B0015" - } ], - "http://sbols.org/v3#hasLocation" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent6" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1", - "http://sbols.org/v3#start" : [ { - "@value" : "848" - } ], - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" - } ], - "http://sbols.org/v3#end" : [ { - "@value" : "968" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Range1" - } ], - "@type" : [ "http://sbols.org/v3#Range" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_R0062" - } ], - "http://sbols.org/v3#hasLocation" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent7" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1", - "http://sbols.org/v3#start" : [ { - "@value" : "969" - } ], - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" - } ], - "http://sbols.org/v3#end" : [ { - "@value" : "1023" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Range1" - } ], - "@type" : [ "http://sbols.org/v3#Range" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1", - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1207" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_F2620_Sequence1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "BBa_F2620 sequence" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_R0040", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000167" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "pTetR" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_R0040" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "TetR repressible promoter" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_R0040_Sequence1", - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1207" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_R0040_Sequence1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "BBa_R0040 sequence" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_R0062", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000167" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "lux pR" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/BBa_R0062_Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_R0062" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Promoter (luxR & HSL regulated -- lux pR)" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/BBa_R0062_Sequence1", - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1207" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_R0062_Sequence1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "BBa_R0062 sequence" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/TetR_protein", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/GO:0003700" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "TetR" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/TetR_protein_Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "TetR_protein" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "TetR protein" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/TetR_protein_Sequence1", - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1208" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "NNNNNNNNNNN" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "TetR_protein_Sequence1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "TetR_protein sequence" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -} ] +{"@graph":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent5","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/BBa_C0062"}],"http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent5/Range1"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent5"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/BBa_C0062","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#name":[{"@value":"luxR"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_C0062_Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_C0062"}],"http://sbols.org/v3#description":[{"@value":"luxR repressor/activator, (no LVA?)"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent5/Range1","http://sbols.org/v3#start":[{"@value":"67"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620_Sequence1"}],"http://sbols.org/v3#end":[{"@value":"847"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/BBa_B0034_Sequence1","http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"aaagaggagaaa"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_B0034_Sequence1"}],"http://sbols.org/v3#description":[{"@value":"BBa_B0034 sequence"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1","http://sbols.org/v3#start":[{"@value":"969"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620_Sequence1"}],"http://sbols.org/v3#end":[{"@value":"1023"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620_Sequence1","http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_F2620_Sequence1"}],"http://sbols.org/v3#description":[{"@value":"BBa_F2620 sequence"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1","http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1208"}],"http://sbols.org/v3#elements":[{"@value":"NNNNNNNNNNN"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_C0062_protein_Sequence1"}],"http://sbols.org/v3#description":[{"@value":"BBa_C0062_protein sequence"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/BBa_B0015/SubComponent2","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/BBa_B0012"}],"http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/BBa_B0012","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#name":[{"@value":"BBa_B0012"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_B0012_Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_B0012"}],"http://sbols.org/v3#description":[{"@value":"Double terminator consisting of BBa_B0010 and BBa_B0012"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1","http://sbols.org/v3#start":[{"@value":"81"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_B0015_Sequence1"}],"http://sbols.org/v3#end":[{"@value":"121"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1","http://sbols.org/v3#start":[{"@value":"55"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620_Sequence1"}],"http://sbols.org/v3#end":[{"@value":"66"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/BBa_C0062_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/BBa_C0062_Sequence1","http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_C0062_Sequence1"}],"http://sbols.org/v3#description":[{"@value":"BBa_C0062 sequence"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/BBa_B0012_Sequence1","http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"tcacactggctcaccttcgggtgggcctttctgcgtttata"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_B0012_Sequence1"}],"http://sbols.org/v3#description":[{"@value":"BBa_B0012 sequence"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/BBa_B0015_Sequence1","http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_B0015_Sequence1"}],"http://sbols.org/v3#description":[{"@value":"BBa_B0015 sequence"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent7","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/BBa_R0062"}],"http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent7"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/BBa_R0062","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000167"}],"http://sbols.org/v3#name":[{"@value":"lux pR"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_R0062_Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_R0062"}],"http://sbols.org/v3#description":[{"@value":"Promoter (luxR & HSL regulated -- lux pR)"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000459"}],"http://sbols.org/v3#participant":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/TetR_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/TetR_protein","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#name":[{"@value":"TetR"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/TetR_protein_Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"TetR_protein"}],"http://sbols.org/v3#description":[{"@value":"TetR protein"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/TetR_protein_Sequence1","http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1208"}],"http://sbols.org/v3#elements":[{"@value":"NNNNNNNNNNN"}],"http://sbols.org/v3#displayId":[{"@value":"TetR_protein_Sequence1"}],"http://sbols.org/v3#description":[{"@value":"TetR_protein sequence"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620","http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent1"},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent3"},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent7"},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent2"},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent6"},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent5"},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent4"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#name":[{"@value":"BBa_F2620"}],"http://sbols.org/v3#description":[{"@value":"PoPS Receiver"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#hasInteraction":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction3"},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction2"},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#displayId":[{"@value":"BBa_F2620"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620_Sequence1"}]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent3","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040"}],"http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction3","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000170"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1"},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction3"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent6","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/BBa_B0015"}],"http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent6"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction2","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000170"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1"},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction2"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent4","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/BBa_B0034"}],"http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent4"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction1","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1"},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction1"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000645"}],"http://sbols.org/v3#participant":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent5"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1","http://sbols.org/v3#start":[{"@value":"848"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620_Sequence1"}],"http://sbols.org/v3#end":[{"@value":"968"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1","http://sbols.org/v3#start":[{"@value":"1"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620_Sequence1"}],"http://sbols.org/v3#end":[{"@value":"54"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/BBa_R0040_Sequence1","http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_R0040_Sequence1"}],"http://sbols.org/v3#description":[{"@value":"BBa_R0040 sequence"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/BBa_B0034","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000139"}],"http://sbols.org/v3#name":[{"@value":"BBa_B0034"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_B0034_Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_B0034"}],"http://sbols.org/v3#description":[{"@value":"RBS based on Elowitz repressilator"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000459"}],"http://sbols.org/v3#participant":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://synbiohub.org/public/igem/BBa_B0015/SubComponent1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/BBa_B0010"}],"http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/BBa_B0010","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#name":[{"@value":"BBa_B0010"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_B0010_Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_B0010"}],"http://sbols.org/v3#description":[{"@value":"Transcriptional terminator consisting of a 64 bp stem-loop"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1","http://sbols.org/v3#start":[{"@value":"1"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_B0015_Sequence1"}],"http://sbols.org/v3#end":[{"@value":"80"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/BBa_R0062_Sequence1","http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_R0062_Sequence1"}],"http://sbols.org/v3#description":[{"@value":"BBa_R0062 sequence"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000643"}],"http://sbols.org/v3#participant":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://synbiohub.org/public/igem/BBa_B0015","http://sbols.org/v3#name":[{"@value":"BBa_B0015"}],"http://sbols.org/v3#description":[{"@value":"Double terminator consisting of BBa_B0010 and BBa_B0012"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_B0015_Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/BBa_B0015/SubComponent2"},{"@id":"https://synbiohub.org/public/igem/BBa_B0015/SubComponent1"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_B0015"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}]},{"@id":"https://synbiohub.org/public/igem/BBa_C0062_protein","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#name":[{"@value":"LuxR"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_C0062_protein"}],"http://sbols.org/v3#description":[{"@value":"LuxR protein"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000643"}],"http://sbols.org/v3#participant":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620/SubComponent7"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://synbiohub.org/public/igem/BBa_B0010_Sequence1","http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_B0010_Sequence1"}],"http://sbols.org/v3#description":[{"@value":"BBa_B0010 sequence"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/BBa_R0040","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000167"}],"http://sbols.org/v3#name":[{"@value":"pTetR"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040_Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_R0040"}],"http://sbols.org/v3#description":[{"@value":"TetR repressible promoter"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.nt b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.nt index 730e8d6..f024e2a 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.nt +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.nt @@ -1,112 +1,84 @@ - "1" . - . - . - "54" . - "Range1" . - . . . . "SubComponent5" . . - "Sequence1" . - . - . - "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac" . - "BBa_C0062_Sequence1" . - "BBa_C0062 sequence" . - . - "Sequence1" . - . - . - "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . - "BBa_B0010_Sequence1" . - "BBa_B0010 sequence" . - . - . - . - "LuxR" . - . - . - "BBa_C0062_protein" . - "LuxR protein" . - . - . - . - . - "Interaction1" . - . + "Sequence1" . + . + . + "aaagaggagaaa" . + "BBa_B0034_Sequence1" . + "BBa_B0034 sequence" . + . "969" . . . "1023" . "Range1" . . - "Sequence1" . - . - . - "tcacactggctcaccttcgggtgggcctttctgcgtttata" . - "BBa_B0012_Sequence1" . - "BBa_B0012 sequence" . - . - . - . - "BBa_B0012" . - . - . - "BBa_B0012" . - "Double terminator consisting of BBa_B0010 and BBa_B0012" . - . - . - . - "pTetR" . - . - . - "BBa_R0040" . - "TetR repressible promoter" . - . - . - . - . - "SubComponent4" . - . + "Sequence1" . + . + . + "NNNNNNNNNNN" . + "BBa_C0062_protein_Sequence1" . + "BBa_C0062_protein sequence" . + . + . + . + . + "SubComponent2" . + . "55" . . . "66" . "Range1" . . - . - . - . - "SubComponent3" . - . - "Sequence1" . - . - . - "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata" . - "BBa_B0015_Sequence1" . - "BBa_B0015 sequence" . - . - "Sequence1" . - . - . - "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" . - "BBa_F2620_Sequence1" . - "BBa_F2620 sequence" . - . . . "Participation2" . . + . + . + "luxR" . + . + . + "BBa_C0062" . + "luxR repressor/activator, (no LVA?)" . + . + . + . + "BBa_B0012" . + . + . + "BBa_B0012" . + "Double terminator consisting of BBa_B0010 and BBa_B0012" . + . + "81" . + . + . + "121" . + "Range1" . + . + . + . + . + "SubComponent7" . + . + "Sequence1" . + . + . + "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac" . + "BBa_C0062_Sequence1" . + "BBa_C0062 sequence" . + . . . "Participation2" . . - . - . - "Participation2" . - . + . + "SubComponent2" . + . "Sequence1" . . . @@ -114,127 +86,99 @@ "TetR_protein_Sequence1" . "TetR_protein sequence" . . - . - . - . - "SubComponent2" . - . - . - . - "BBa_B0010" . - . - . - "BBa_B0010" . - "Transcriptional terminator consisting of a 64 bp stem-loop" . - . - . - . - "TetR" . - . - . - "TetR_protein" . - "TetR protein" . - . - . - "SubComponent2" . - . - . - . - "Participation1" . - . - "Sequence1" . - . - . - "aaagaggagaaa" . - "BBa_B0034_Sequence1" . - "BBa_B0034 sequence" . - . - . - . - "Participation1" . - . + "Sequence1" . + . + . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata" . + "BBa_B0015_Sequence1" . + "BBa_B0015 sequence" . + . + . + . + "BBa_F2620" . + . + . + . + "PoPS Receiver" . + . + . + . + . + . + . + "BBa_F2620" . + . + . + . + . + . + . + . + "Interaction1" . + . + "848" . + . + . + "968" . + "Range1" . + . + "1" . + . + . + "54" . + "Range1" . + . + "Sequence1" . + . + . + "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" . + "BBa_R0040_Sequence1" . + "BBa_R0040 sequence" . + . + . + . + . + "SubComponent4" . + . + . + . + "Participation2" . + . + . + . + . + "SubComponent1" . + . "1" . . . "80" . "Range1" . . - . - . - "Participation1" . - . - . - . - . - . - . - "Double terminator consisting of BBa_B0010 and BBa_B0012" . - . - . - "BBa_B0015" . - "BBa_B0015" . - "Sequence1" . - . - . - "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" . - "BBa_R0062_Sequence1" . - "BBa_R0062 sequence" . - . - . - . - . - "SubComponent1" . - . - . - . - . - "SubComponent7" . - . - . - . - . - . - "BBa_F2620" . - . - . - . - . - . - . - "BBa_F2620" . - . - . - "PoPS Receiver" . - . - . - . - "67" . - . - . - "847" . - "Range1" . - . - . - "SubComponent1" . - . - "Sequence1" . - . - . - "NNNNNNNNNNN" . - "BBa_C0062_protein_Sequence1" . - "BBa_C0062_protein sequence" . - . + . + . + "Participation1" . + . + . + . + "lux pR" . + . + . + "BBa_R0062" . + "Promoter (luxR & HSL regulated -- lux pR)" . + . . . . "Interaction3" . . - "81" . - . - . - "121" . - "Range1" . - . + "Sequence1" . + . + . + "tcacactggctcaccttcgggtgggcctttctgcgtttata" . + "BBa_B0012_Sequence1" . + "BBa_B0012 sequence" . + . . . . @@ -248,37 +192,93 @@ "BBa_B0034" . "RBS based on Elowitz repressilator" . . - . - . - "lux pR" . - . - . - "BBa_R0062" . - "Promoter (luxR & HSL regulated -- lux pR)" . - . - "848" . - . - . - "968" . - "Range1" . - . - "Sequence1" . - . - . - "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" . - "BBa_R0040_Sequence1" . - "BBa_R0040 sequence" . - . + . + "SubComponent1" . + . + . + . + "Participation1" . + . + . + . + "TetR" . + . + . + "TetR_protein" . + "TetR protein" . + . + "67" . + . + . + "847" . + "Range1" . + . + "Sequence1" . + . + . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + "BBa_B0010_Sequence1" . + "BBa_B0010 sequence" . + . + "Sequence1" . + . + . + "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" . + "BBa_R0062_Sequence1" . + "BBa_R0062 sequence" . + . + . + . + . + "SubComponent3" . + . + . + . + "Participation1" . + . + "BBa_B0015" . + "Double terminator consisting of BBa_B0010 and BBa_B0012" . + . + . + . + . + "BBa_B0015" . + . + . + . + . + . + "LuxR" . + . + . + "BBa_C0062_protein" . + "LuxR protein" . + . + . + . + "BBa_B0010" . + . + . + "BBa_B0010" . + "Transcriptional terminator consisting of a 64 bp stem-loop" . + . . . . "Interaction2" . . - . - . - "luxR" . - . - . - "BBa_C0062" . - "luxR repressor/activator, (no LVA?)" . - . + "Sequence1" . + . + . + "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" . + "BBa_F2620_Sequence1" . + "BBa_F2620 sequence" . + . + . + . + "pTetR" . + . + . + "BBa_R0040" . + "TetR repressible promoter" . + . diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rdf b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rdf index 3ee5ac0..1ff2c02 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rdf +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rdf @@ -10,6 +10,57 @@ xmlns="https://synbiohub.org/public/igem/" xmlns:om="http://www.ontology-of-units-of-measure.org/resource/om-2/" xml:base="https://synbiohub.org/public/igem/"> + + BBa_B0015 + Double terminator consisting of BBa_B0010 and BBa_B0012 + + + + + + + + + + + + + 81 + + + + + 121 + Range1 + + + SubComponent2 + + + + BBa_B0015 + + + + + + + + + 1 + + + + + 80 + Range1 + + + SubComponent1 + + + + @@ -21,6 +72,28 @@ TetR_protein TetR protein + + + + BBa_B0012 + + + + + BBa_B0012 + Double terminator consisting of BBa_B0010 and BBa_B0012 + + + + + BBa_B0034 + + + + + BBa_B0034 + RBS based on Elowitz repressilator + @@ -32,128 +105,43 @@ BBa_C0062_protein LuxR protein - + - - pTetR + + luxR - + - BBa_R0040 - TetR repressible promoter + BBa_C0062 + luxR repressor/activator, (no LVA?) - + - - lux pR + + BBa_B0010 - + - BBa_R0062 - Promoter (luxR &amp; HSL regulated -- lux pR) + BBa_B0010 + Transcriptional terminator consisting of a 64 bp stem-loop - - - SubComponent2 + + + SubComponent1 - - - - - - - - - - - - - 969 - - - - - 1023 - Range1 - - - SubComponent7 - - - Participation1 - - - - - - - - - SubComponent1 - - - Participation2 - - - Interaction2 - - - - - - - BBa_F2620 - + BBa_F2620 - + - + - - - 67 - - - - - 847 - Range1 - - - SubComponent5 - - - - - - - - - - Participation1 - - - - - - - Participation2 - - - Interaction1 - - - - - - 1 @@ -168,50 +156,34 @@ SubComponent3 - BBa_F2620 - + - + - - 55 + + 969 - 66 + 1023 Range1 - SubComponent4 + SubComponent7 - - - - - - - - 848 - - - - - 968 - Range1 - - - SubComponent6 + + + SubComponent2 PoPS Receiver - @@ -232,97 +204,127 @@ Interaction3 - - - - - BBa_B0010 - - - - - BBa_B0010 - Transcriptional terminator consisting of a 64 bp stem-loop - - - - - BBa_B0012 - - - - - BBa_B0012 - Double terminator consisting of BBa_B0010 and BBa_B0012 - - - - - BBa_B0034 - - - - - BBa_B0034 - RBS based on Elowitz repressilator - - - - - - - + - + - - 81 + + 848 - + - 121 + 968 Range1 - SubComponent2 + SubComponent6 + - + - + - - 1 + + 67 - + - 80 + 847 Range1 - SubComponent1 + SubComponent5 - Double terminator consisting of BBa_B0010 and BBa_B0012 + BBa_F2620 + + + + + + + + Participation1 + + + + + + + Participation2 + + + Interaction2 + + + + + + + + + 55 + + + + + 66 + Range1 + + + SubComponent4 + + + + + + + + + + + + + Participation1 + + + + + + + Participation2 + + + Interaction1 + + + + + + + lux pR + + + - - BBa_B0015 - BBa_B0015 + BBa_R0062 + Promoter (luxR &amp; HSL regulated -- lux pR) - + - - luxR + + pTetR - + - BBa_C0062 - luxR repressor/activator, (no LVA?) + BBa_R0040 + TetR repressible promoter Sequence1 @@ -332,13 +334,13 @@ BBa_F2620_Sequence1 BBa_F2620 sequence - + Sequence1 - ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata - BBa_B0015_Sequence1 - BBa_B0015 sequence + aaagaggagaaa + BBa_B0034_Sequence1 + BBa_B0034 sequence Sequence1 @@ -348,13 +350,21 @@ BBa_R0062_Sequence1 BBa_R0062 sequence - + + Sequence1 + + + NNNNNNNNNNN + TetR_protein_Sequence1 + TetR_protein sequence + + Sequence1 - aaagaggagaaa - BBa_B0034_Sequence1 - BBa_B0034 sequence + atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac + BBa_C0062_Sequence1 + BBa_C0062 sequence Sequence1 @@ -364,21 +374,13 @@ BBa_B0010_Sequence1 BBa_B0010 sequence - - Sequence1 - - - NNNNNNNNNNN - TetR_protein_Sequence1 - TetR_protein sequence - - + Sequence1 - tcacactggctcaccttcgggtgggcctttctgcgtttata - BBa_B0012_Sequence1 - BBa_B0012 sequence + tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac + BBa_R0040_Sequence1 + BBa_R0040 sequence Sequence1 @@ -388,20 +390,20 @@ BBa_C0062_protein_Sequence1 BBa_C0062_protein sequence - + Sequence1 - tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac - BBa_R0040_Sequence1 - BBa_R0040 sequence + tcacactggctcaccttcgggtgggcctttctgcgtttata + BBa_B0012_Sequence1 + BBa_B0012 sequence - + Sequence1 - atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac - BBa_C0062_Sequence1 - BBa_C0062 sequence + ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata + BBa_B0015_Sequence1 + BBa_B0015 sequence diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rj b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rj index 4655377..d09070d 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rj +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.rj @@ -1,83 +1,88 @@ { - "https://synbiohub.org/public/igem/BBa_F2620/Interaction1" : { + "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interaction1" + "value" : "SubComponent1" } ] , - "http://sbols.org/v3#hasParticipation" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2" - } - , { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1" + "value" : "https://synbiohub.org/public/igem/BBa_C0062_protein" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Interaction" - } - ] , - "http://sbols.org/v3#type" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000589" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://synbiohub.org/public/igem/TetR_protein" : { + "https://synbiohub.org/public/igem/BBa_B0015" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1" + } + , { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "TetR_protein" + "value" : "BBa_B0015" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/GO:0003700" + "value" : "https://identifiers.org/SO:0000141" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Double terminator consisting of BBa_B0010 and BBa_B0012" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://synbiohub.org/public/igem" } ] , "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/TetR_protein_Sequence1" + "value" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "value" : "https://identifiers.org/SBO:0000251" } ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "TetR" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "TetR protein" + "value" : "BBa_B0015" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" : { + "https://synbiohub.org/public/igem/TetR_protein_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1208" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_B0015_Sequence1" + "value" : "TetR_protein_Sequence1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "NNNNNNNNNNN" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -85,9 +90,9 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#elements" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata" + "value" : "TetR_protein sequence" } ] , "http://sbols.org/v3#name" : [ { @@ -95,187 +100,238 @@ "value" : "Sequence1" } ] , - "http://sbols.org/v3#encoding" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "BBa_B0015 sequence" + "value" : "http://sbols.org/v3#Sequence" } ] } , - "https://synbiohub.org/public/igem/BBa_R0062_Sequence1" : { + "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_R0062_Sequence1" + "value" : "Participation2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "value" : "https://identifiers.org/SBO:0000011" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" } ] , - "http://sbols.org/v3#elements" : [ { - "type" : "literal" , - "value" : "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Sequence1" + "value" : "SubComponent6" } ] , - "http://sbols.org/v3#encoding" : [ { + "http://sbols.org/v3#hasLocation" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "BBa_R0062 sequence" + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_B0015" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/Interaction3" : { + "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interaction3" + "value" : "SubComponent7" } ] , - "http://sbols.org/v3#hasParticipation" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2" - } - , { + "http://sbols.org/v3#hasLocation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Interaction" + "value" : "https://synbiohub.org/public/igem/BBa_R0062" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000170" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620" : { + "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_F2620" + "value" : "BBa_R0040_Sequence1" } ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0000704" + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#hasSequence" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "BBa_R0040 sequence" } ] , - "http://sbols.org/v3#hasNamespace" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" } ] , - "http://sbols.org/v3#hasFeature" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6" + "value" : "http://sbols.org/v3#Sequence" } - , { + ] + } + , + "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" + "value" : "https://identifiers.org/SO:0001030" } - , { + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent4" + } + ] , + "http://sbols.org/v3#hasLocation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1" } - , { + ] , + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" + "value" : "https://synbiohub.org/public/igem/BBa_B0034" } - , { + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" + "value" : "http://sbols.org/v3#SubComponent" } - , { + ] + } + , + "https://synbiohub.org/public/igem/BBa_C0062_protein" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_C0062_protein" + } + ] , + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4" + "value" : "https://identifiers.org/GO:0003700" } - , { + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3" + "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "BBa_F2620" + "value" : "LuxR protein" } ] , - "http://sbols.org/v3#hasInteraction" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1" - } - , { + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3" + "value" : "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1" } - , { + ] , + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2" + "value" : "https://identifiers.org/SBO:0000252" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "PoPS Receiver" + "value" : "LuxR" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/BBa_B0010" : { + "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_B0010" + "value" : "SubComponent5" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#hasLocation" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000141" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5/Range1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_C0062" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_C0062" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_C0062" } ] , - "http://sbols.org/v3#hasSequence" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0010_Sequence1" + "value" : "https://identifiers.org/SO:0000316" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -283,65 +339,65 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "BBa_B0010" + "value" : "luxR repressor/activator, (no LVA?)" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Transcriptional terminator consisting of a 64 bp stem-loop" + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_C0062_Sequence1" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" - } - ] - } - , - "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" } ] , - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Participation2" - } - ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000459" + "value" : "luxR" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/BBa_B0012" : { + "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_B0012" + "value" : "SubComponent2" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000141" + "value" : "https://synbiohub.org/public/igem/TetR_protein" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#SubComponent" } - ] , - "http://sbols.org/v3#hasSequence" : [ { + ] + } + , + "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0012_Sequence1" + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_B0015_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -349,42 +405,55 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "BBa_B0012" + "value" : "BBa_B0015 sequence" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Double terminator consisting of BBa_B0010 and BBa_B0012" + "value" : "Sequence1" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Sequence" } ] } , - "https://synbiohub.org/public/igem/BBa_B0034" : { + "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_B0034" + "value" : "Participation1" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000139" + "value" : "https://identifiers.org/SBO:0000645" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_R0062" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_R0062" } ] , - "http://sbols.org/v3#hasSequence" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0034_Sequence1" + "value" : "https://identifiers.org/SO:0000167" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -392,70 +461,70 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "BBa_B0034" + "value" : "Promoter (luxR & HSL regulated -- lux pR)" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "RBS based on Elowitz repressilator" + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0062_Sequence1" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" } - ] - } - , - "https://synbiohub.org/public/igem/TetR_protein_Sequence1" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "TetR_protein_Sequence1" + "value" : "lux pR" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "value" : "http://sbols.org/v3#Component" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + ] + } + , + "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#elements" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "NNNNNNNNNNN" + "value" : "SubComponent3" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "Sequence1" + "http://sbols.org/v3#hasLocation" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1" } ] , - "http://sbols.org/v3#encoding" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1208" + "value" : "https://synbiohub.org/public/igem/BBa_R0040" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "TetR_protein sequence" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://synbiohub.org/public/igem/BBa_B0012_Sequence1" : { + "https://synbiohub.org/public/igem/BBa_R0040" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_B0012_Sequence1" + "value" : "BBa_R0040" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "value" : "https://identifiers.org/SO:0000167" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -463,98 +532,108 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#elements" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "tcacactggctcaccttcgggtgggcctttctgcgtttata" + "value" : "TetR repressible promoter" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "Sequence1" + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" } ] , - "http://sbols.org/v3#encoding" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "BBa_B0012 sequence" + "value" : "pTetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "BBa_C0062_protein_Sequence1" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#hasNamespace" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "121" } ] , - "http://sbols.org/v3#elements" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "NNNNNNNNNNN" + "value" : "Range1" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#start" : [ { "type" : "literal" , - "value" : "Sequence1" + "value" : "81" } ] , - "http://sbols.org/v3#encoding" : [ { + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1208" + "value" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "BBa_C0062_protein sequence" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Range" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1" : { - "http://sbols.org/v3#participant" : [ { + "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "80" } ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation1" + "value" : "Range1" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#start" : [ { + "type" : "literal" , + "value" : "1" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000643" + "value" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Range" } ] } , - "https://synbiohub.org/public/igem/BBa_C0062_Sequence1" : { + "https://synbiohub.org/public/igem/TetR_protein" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_C0062_Sequence1" + "value" : "TetR_protein" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "value" : "https://identifiers.org/GO:0003700" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -562,233 +641,214 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#elements" : [ { - "type" : "literal" , - "value" : "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "Sequence1" - } - ] , - "http://sbols.org/v3#encoding" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "BBa_C0062 sequence" - } - ] - } - , - "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "SubComponent5" + "value" : "TetR protein" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://synbiohub.org/public/igem/TetR_protein_Sequence1" } ] , - "http://sbols.org/v3#hasLocation" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5/Range1" + "value" : "https://identifiers.org/SBO:0000252" } ] , - "http://sbols.org/v3#orientation" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "TetR" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_C0062" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/BBa_C0062_protein" : { + "https://synbiohub.org/public/igem/BBa_B0012" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_C0062_protein" + "value" : "BBa_B0012" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/GO:0003700" + "value" : "https://identifiers.org/SO:0000141" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Double terminator consisting of BBa_B0010 and BBa_B0012" } ] , "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1" + "value" : "https://synbiohub.org/public/igem/BBa_B0012_Sequence1" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "value" : "https://identifiers.org/SBO:0000251" } ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "LuxR" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "LuxR protein" + "value" : "BBa_B0012" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1" : { + "https://synbiohub.org/public/igem/BBa_B0034" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent1" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "BBa_B0034" } ] , - "http://sbols.org/v3#hasLocation" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1" + "value" : "https://identifiers.org/SO:0000139" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#instanceOf" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0010" - } - ] - } - , - "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" : { - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "SubComponent7" + "value" : "RBS based on Elowitz repressilator" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://synbiohub.org/public/igem/BBa_B0034_Sequence1" } ] , - "http://sbols.org/v3#hasLocation" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#orientation" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "BBa_B0034" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_R0062" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" : { + "https://synbiohub.org/public/igem/BBa_B0010" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent1" + "value" : "BBa_B0010" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SO:0000141" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_C0062_protein" + "value" : "https://synbiohub.org/public/igem" } - ] - } - , - "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "SubComponent3" + "value" : "Transcriptional terminator consisting of a 64 bp stem-loop" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://synbiohub.org/public/igem/BBa_B0010_Sequence1" } ] , - "http://sbols.org/v3#hasLocation" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#orientation" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "BBa_B0010" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_R0040" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2" : { - "http://sbols.org/v3#participant" : [ { + "https://synbiohub.org/public/igem/BBa_C0062_protein_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" + "value" : "https://identifiers.org/edam:format_1208" } ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation2" + "value" : "BBa_C0062_protein_Sequence1" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "NNNNNNNNNNN" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000011" + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "BBa_C0062_protein sequence" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Sequence" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" : { + "https://synbiohub.org/public/igem/BBa_B0012_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_F2620_Sequence1" + "value" : "BBa_B0012_Sequence1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "tcacactggctcaccttcgggtgggcctttctgcgtttata" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -796,9 +856,9 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#elements" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" + "value" : "BBa_B0012 sequence" } ] , "http://sbols.org/v3#name" : [ { @@ -806,32 +866,32 @@ "value" : "Sequence1" } ] , - "http://sbols.org/v3#encoding" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "BBa_F2620 sequence" + "value" : "http://sbols.org/v3#Sequence" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1" : { - "http://sbols.org/v3#displayId" : [ { + "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#end" : [ { "type" : "literal" , - "value" : "Range1" + "value" : "66" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Range" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Range1" } ] , "http://sbols.org/v3#start" : [ { "type" : "literal" , - "value" : "969" + "value" : "55" } ] , "http://sbols.org/v3#hasSequence" : [ { @@ -839,37 +899,27 @@ "value" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" - } - ] , - "http://sbols.org/v3#end" : [ { - "type" : "literal" , - "value" : "1023" + "value" : "http://sbols.org/v3#Range" } ] } , - "https://synbiohub.org/public/igem/BBa_R0040" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "BBa_R0040" - } - ] , - "http://sbols.org/v3#role" : [ { + "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000167" + "value" : "https://identifiers.org/edam:format_1207" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_F2620_Sequence1" } ] , - "http://sbols.org/v3#hasSequence" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -877,95 +927,123 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "pTetR" + "value" : "BBa_F2620 sequence" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "TetR repressible promoter" + "value" : "Sequence1" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Sequence" } ] } , - "https://synbiohub.org/public/igem/BBa_R0062" : { + "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "54" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_R0062" + "value" : "Range1" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#start" : [ { + "type" : "literal" , + "value" : "1" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000167" + "value" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#Range" } - ] , - "http://sbols.org/v3#hasSequence" : [ { + ] + } + , + "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5/Range1" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_R0062_Sequence1" + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#hasNamespace" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "847" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "lux pR" + "value" : "Range1" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#start" : [ { "type" : "literal" , - "value" : "Promoter (luxR & HSL regulated -- lux pR)" + "value" : "67" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Range" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "Range1" + "https://synbiohub.org/public/igem/BBa_R0062_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Range" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_R0062_Sequence1" } ] , - "http://sbols.org/v3#start" : [ { + "http://sbols.org/v3#elements" : [ { "type" : "literal" , - "value" : "848" + "value" : "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" } ] , - "http://sbols.org/v3#hasSequence" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#orientation" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "BBa_R0062 sequence" } ] , - "http://sbols.org/v3#end" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "968" + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" } ] } @@ -976,36 +1054,41 @@ "value" : "Interaction2" } ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000170" + } + ] , "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1" } , { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Interaction" - } - ] , - "http://sbols.org/v3#type" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000170" } ] } , - "https://synbiohub.org/public/igem/BBa_B0010_Sequence1" : { + "https://synbiohub.org/public/igem/BBa_C0062_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_B0010_Sequence1" + "value" : "BBa_C0062_Sequence1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -1013,9 +1096,9 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#elements" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" + "value" : "BBa_C0062 sequence" } ] , "http://sbols.org/v3#name" : [ { @@ -1023,111 +1106,97 @@ "value" : "Sequence1" } ] , - "http://sbols.org/v3#encoding" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "BBa_B0010 sequence" + "value" : "http://sbols.org/v3#Sequence" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3" - } - ] , + "https://synbiohub.org/public/igem/BBa_F2620/Interaction1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation1" + "value" : "Interaction1" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000643" + "value" : "https://identifiers.org/SBO:0000589" + } + ] , + "http://sbols.org/v3#hasParticipation" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation2" + } + , { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Interaction" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "Range1" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "https://synbiohub.org/public/igem/BBa_B0010_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Range" + "value" : "https://identifiers.org/edam:format_1207" } ] , - "http://sbols.org/v3#start" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "55" + "value" : "BBa_B0010_Sequence1" } ] , - "http://sbols.org/v3#hasSequence" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#end" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "66" - } - ] - } - , - "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" + "value" : "BBa_B0010 sequence" } ] , - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Participation2" - } - ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000459" + "value" : "Sequence1" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Sequence" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5/Range1" : { - "http://sbols.org/v3#displayId" : [ { + "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7/Range1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#end" : [ { "type" : "literal" , - "value" : "Range1" + "value" : "1023" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Range" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Range1" } ] , "http://sbols.org/v3#start" : [ { "type" : "literal" , - "value" : "67" + "value" : "969" } ] , "http://sbols.org/v3#hasSequence" : [ { @@ -1135,6 +1204,14 @@ "value" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" } ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Range" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1" : { "http://sbols.org/v3#orientation" : [ { "type" : "uri" , "value" : "https://identifiers.org/SO:0001030" @@ -1142,160 +1219,146 @@ ] , "http://sbols.org/v3#end" : [ { "type" : "literal" , - "value" : "847" + "value" : "968" } - ] - } - , - "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1" : { + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "Range1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Range" - } - ] , "http://sbols.org/v3#start" : [ { "type" : "literal" , - "value" : "81" + "value" : "848" } ] , "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" + "value" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" - } - ] , - "http://sbols.org/v3#end" : [ { - "type" : "literal" , - "value" : "121" + "value" : "http://sbols.org/v3#Range" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6" : { + "https://synbiohub.org/public/igem/BBa_F2620/Interaction3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent6" + "value" : "Interaction3" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000170" } ] , - "http://sbols.org/v3#hasLocation" : [ { + "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6/Range1" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1" } - ] , - "http://sbols.org/v3#orientation" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0015" + "value" : "http://sbols.org/v3#Interaction" } ] } , - "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "SubComponent2" + "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" } ] , "http://sbols.org/v3#hasLocation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1" + "value" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://synbiohub.org/public/igem/BBa_B0010" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0012" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3/Range1" : { + "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Range1" + "value" : "Participation1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Range" - } - ] , - "http://sbols.org/v3#start" : [ { - "type" : "literal" , - "value" : "1" + "value" : "https://identifiers.org/SBO:0000643" } ] , - "http://sbols.org/v3#hasSequence" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" - } - ] , - "http://sbols.org/v3#end" : [ { - "type" : "literal" , - "value" : "54" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" : { + "https://synbiohub.org/public/igem/BBa_F2620/Interaction3/Participation2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "Participation2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000459" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/TetR_protein" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" } ] } , "https://synbiohub.org/public/igem/BBa_B0034_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "BBa_B0034_Sequence1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "aaagaggagaaa" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -1303,9 +1366,9 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#elements" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "aaagaggagaaa" + "value" : "BBa_B0034 sequence" } ] , "http://sbols.org/v3#name" : [ { @@ -1313,231 +1376,168 @@ "value" : "Sequence1" } ] , - "http://sbols.org/v3#encoding" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "BBa_B0034 sequence" + "value" : "http://sbols.org/v3#Sequence" } ] } , - "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1/Range1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "Range1" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Range" + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#start" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "1" + "value" : "SubComponent2" } ] , - "http://sbols.org/v3#hasSequence" : [ { + "http://sbols.org/v3#hasLocation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" + "value" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2/Range1" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://synbiohub.org/public/igem/BBa_B0012" } ] , - "http://sbols.org/v3#end" : [ { - "type" : "literal" , - "value" : "80" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4" : { + "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent4" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "Participation1" } ] , - "http://sbols.org/v3#hasLocation" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4/Range1" + "value" : "https://identifiers.org/SBO:0000643" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0034" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://synbiohub.org/public/igem/BBa_B0015" : { + "https://synbiohub.org/public/igem/BBa_F2620/Interaction2/Participation2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_B0015" + "value" : "Participation2" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000141" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SBO:0000459" } ] , - "http://sbols.org/v3#hasSequence" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0015_Sequence1" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "value" : "http://sbols.org/v3#Participation" } - ] , + ] + } + , + "https://synbiohub.org/public/igem/BBa_F2620" : { "http://sbols.org/v3#hasFeature" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent1" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent1" } , { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_B0015/SubComponent2" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "BBa_B0015" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Double terminator consisting of BBa_B0010 and BBa_B0012" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent6" } - ] , - "http://sbols.org/v3#type" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" - } - ] - } - , - "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "BBa_R0040_Sequence1" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent7" } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + , { "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent4" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + , { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" - } - ] , - "http://sbols.org/v3#elements" : [ { - "type" : "literal" , - "value" : "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "Sequence1" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" } - ] , - "http://sbols.org/v3#encoding" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "BBa_R0040 sequence" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent2" } - ] - } - , - "https://synbiohub.org/public/igem/BBa_F2620/Interaction1/Participation1" : { - "http://sbols.org/v3#participant" : [ { + , { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent5" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/SubComponent3" } ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation1" + "value" : "BBa_F2620" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000645" + "value" : "https://identifiers.org/SO:0000704" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "https://synbiohub.org/public/igem" } - ] - } - , - "https://synbiohub.org/public/igem/BBa_C0062" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "BBa_C0062" + "value" : "PoPS Receiver" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000316" + "value" : "https://synbiohub.org/public/igem/BBa_F2620_Sequence1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#hasSequence" : [ { + "http://sbols.org/v3#hasInteraction" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/BBa_C0062_Sequence1" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction2" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + , { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction1" } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "luxR" + , { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_F2620/Interaction3" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "luxR repressor/activator, (no LVA?)" + "value" : "BBa_F2620" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Component" } ] } diff --git a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.ttl b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.ttl index bf80d8e..fed2beb 100644 --- a/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.ttl +++ b/SBOL3/BBa_F2620_PoPSReceiver/BBa_F2620_PoPSReceiver.ttl @@ -1,354 +1,354 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . - - - a sbol:Range ; - sbol:displayId "Range1" ; - sbol:end "54" ; - sbol:hasSequence :BBa_F2620_Sequence1 ; - sbol:orientation SO:0001030 ; - sbol:start "1" . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: - a sbol:SubComponent ; - sbol:displayId "SubComponent5" ; - sbol:hasLocation ; - sbol:instanceOf :BBa_C0062 ; + a sbol:SubComponent; + sbol:displayId "SubComponent5"; + sbol:hasLocation ; + sbol:instanceOf :BBa_C0062; sbol:orientation SO:0001030 . -:BBa_C0062_Sequence1 a sbol:Sequence ; - sbol:description "BBa_C0062 sequence" ; - sbol:displayId "BBa_C0062_Sequence1" ; - sbol:elements "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace <../igem> ; +:BBa_B0034_Sequence1 a sbol:Sequence; + sbol:description "BBa_B0034 sequence"; + sbol:displayId "BBa_B0034_Sequence1"; + sbol:elements "aaagaggagaaa"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; sbol:name "Sequence1" . -:BBa_B0010_Sequence1 a sbol:Sequence ; - sbol:description "BBa_B0010 sequence" ; - sbol:displayId "BBa_B0010_Sequence1" ; - sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace <../igem> ; - sbol:name "Sequence1" . - -:BBa_C0062_protein a sbol:Component ; - sbol:description "LuxR protein" ; - sbol:displayId "BBa_C0062_protein" ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :BBa_C0062_protein_Sequence1 ; - sbol:name "LuxR" ; - sbol:role GO:0003700 ; - sbol:type SBO:0000252 . - - - a sbol:Interaction ; - sbol:displayId "Interaction1" ; - sbol:hasParticipation , ; - sbol:type SBO:0000589 . - - a sbol:Range ; - sbol:displayId "Range1" ; - sbol:end "1023" ; - sbol:hasSequence :BBa_F2620_Sequence1 ; - sbol:orientation SO:0001030 ; + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "1023"; + sbol:hasSequence :BBa_F2620_Sequence1; + sbol:orientation SO:0001030; sbol:start "969" . -:BBa_B0012_Sequence1 a sbol:Sequence ; - sbol:description "BBa_B0012 sequence" ; - sbol:displayId "BBa_B0012_Sequence1" ; - sbol:elements "tcacactggctcaccttcgggtgggcctttctgcgtttata" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace <../igem> ; +:BBa_C0062_protein_Sequence1 + a sbol:Sequence; + sbol:description "BBa_C0062_protein sequence"; + sbol:displayId "BBa_C0062_protein_Sequence1"; + sbol:elements "NNNNNNNNNNN"; + sbol:encoding EDAM:format_1208; + sbol:hasNamespace <../igem>; sbol:name "Sequence1" . -:BBa_B0012 a sbol:Component ; - sbol:description "Double terminator consisting of BBa_B0010 and BBa_B0012" ; - sbol:displayId "BBa_B0012" ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :BBa_B0012_Sequence1 ; - sbol:name "BBa_B0012" ; - sbol:role SO:0000141 ; - sbol:type SBO:0000251 . - -:BBa_R0040 a sbol:Component ; - sbol:description "TetR repressible promoter" ; - sbol:displayId "BBa_R0040" ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :BBa_R0040_Sequence1 ; - sbol:name "pTetR" ; - sbol:role SO:0000167 ; - sbol:type SBO:0000251 . - - - a sbol:SubComponent ; - sbol:displayId "SubComponent4" ; - sbol:hasLocation ; - sbol:instanceOf :BBa_B0034 ; + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:hasLocation ; + sbol:instanceOf :BBa_B0012; sbol:orientation SO:0001030 . - a sbol:Range ; - sbol:displayId "Range1" ; - sbol:end "66" ; - sbol:hasSequence :BBa_F2620_Sequence1 ; - sbol:orientation SO:0001030 ; + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "66"; + sbol:hasSequence :BBa_F2620_Sequence1; + sbol:orientation SO:0001030; sbol:start "55" . - - a sbol:SubComponent ; - sbol:displayId "SubComponent3" ; - sbol:hasLocation ; - sbol:instanceOf :BBa_R0040 ; - sbol:orientation SO:0001030 . + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000011 . -:BBa_B0015_Sequence1 a sbol:Sequence ; - sbol:description "BBa_B0015 sequence" ; - sbol:displayId "BBa_B0015_Sequence1" ; - sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace <../igem> ; - sbol:name "Sequence1" . +:BBa_C0062 a sbol:Component; + sbol:description "luxR repressor/activator, (no LVA?)"; + sbol:displayId "BBa_C0062"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :BBa_C0062_Sequence1; + sbol:name "luxR"; + sbol:role SO:0000316; + sbol:type SBO:0000251 . -:BBa_F2620_Sequence1 a sbol:Sequence ; - sbol:description "BBa_F2620 sequence" ; - sbol:displayId "BBa_F2620_Sequence1" ; - sbol:elements "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace <../igem> ; - sbol:name "Sequence1" . +:BBa_B0012 a sbol:Component; + sbol:description "Double terminator consisting of BBa_B0010 and BBa_B0012"; + sbol:displayId "BBa_B0012"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :BBa_B0012_Sequence1; + sbol:name "BBa_B0012"; + sbol:role SO:0000141; + sbol:type SBO:0000251 . - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; - sbol:role SBO:0000011 . + + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "121"; + sbol:hasSequence :BBa_B0015_Sequence1; + sbol:orientation SO:0001030; + sbol:start "81" . + + + a sbol:SubComponent; + sbol:displayId "SubComponent7"; + sbol:hasLocation ; + sbol:instanceOf :BBa_R0062; + sbol:orientation SO:0001030 . + +:BBa_C0062_Sequence1 a sbol:Sequence; + sbol:description "BBa_C0062 sequence"; + sbol:displayId "BBa_C0062_Sequence1"; + sbol:elements "atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; sbol:role SBO:0000459 . - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; - sbol:role SBO:0000459 . + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :TetR_protein . :TetR_protein_Sequence1 - a sbol:Sequence ; - sbol:description "TetR_protein sequence" ; - sbol:displayId "TetR_protein_Sequence1" ; - sbol:elements "NNNNNNNNNNN" ; - sbol:encoding EDAM:format_1208 ; - sbol:hasNamespace <../igem> ; + a sbol:Sequence; + sbol:description "TetR_protein sequence"; + sbol:displayId "TetR_protein_Sequence1"; + sbol:elements "NNNNNNNNNNN"; + sbol:encoding EDAM:format_1208; + sbol:hasNamespace <../igem>; sbol:name "Sequence1" . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:hasLocation ; - sbol:instanceOf :BBa_B0012 ; - sbol:orientation SO:0001030 . +:BBa_B0015_Sequence1 a sbol:Sequence; + sbol:description "BBa_B0015 sequence"; + sbol:displayId "BBa_B0015_Sequence1"; + sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . -:BBa_B0010 a sbol:Component ; - sbol:description "Transcriptional terminator consisting of a 64 bp stem-loop" ; - sbol:displayId "BBa_B0010" ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :BBa_B0010_Sequence1 ; - sbol:name "BBa_B0010" ; - sbol:role SO:0000141 ; - sbol:type SBO:0000251 . +:BBa_F2620 a sbol:Component; + sbol:description "PoPS Receiver"; + sbol:displayId "BBa_F2620"; + sbol:hasFeature , , , , , , ; + sbol:hasInteraction , , ; + sbol:hasNamespace <../igem>; + sbol:hasSequence :BBa_F2620_Sequence1; + sbol:name "BBa_F2620"; + sbol:role SO:0000704; + sbol:type SBO:0000251 . -:TetR_protein a sbol:Component ; - sbol:description "TetR protein" ; - sbol:displayId "TetR_protein" ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :TetR_protein_Sequence1 ; - sbol:name "TetR" ; - sbol:role GO:0003700 ; - sbol:type SBO:0000252 . + + a sbol:Interaction; + sbol:displayId "Interaction1"; + sbol:hasParticipation , ; + sbol:type SBO:0000589 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :TetR_protein . + + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "968"; + sbol:hasSequence :BBa_F2620_Sequence1; + sbol:orientation SO:0001030; + sbol:start "848" . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000643 . + + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "54"; + sbol:hasSequence :BBa_F2620_Sequence1; + sbol:orientation SO:0001030; + sbol:start "1" . -:BBa_B0034_Sequence1 a sbol:Sequence ; - sbol:description "BBa_B0034 sequence" ; - sbol:displayId "BBa_B0034_Sequence1" ; - sbol:elements "aaagaggagaaa" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace <../igem> ; +:BBa_R0040_Sequence1 a sbol:Sequence; + sbol:description "BBa_R0040 sequence"; + sbol:displayId "BBa_R0040_Sequence1"; + sbol:elements "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; sbol:name "Sequence1" . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000645 . + + a sbol:SubComponent; + sbol:displayId "SubComponent4"; + sbol:hasLocation ; + sbol:instanceOf :BBa_B0034; + sbol:orientation SO:0001030 . + + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000459 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:hasLocation ; + sbol:instanceOf :BBa_B0010; + sbol:orientation SO:0001030 . - a sbol:Range ; - sbol:displayId "Range1" ; - sbol:end "80" ; - sbol:hasSequence :BBa_B0015_Sequence1 ; - sbol:orientation SO:0001030 ; + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "80"; + sbol:hasSequence :BBa_B0015_Sequence1; + sbol:orientation SO:0001030; sbol:start "1" . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000643 . + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000645 . -:BBa_B0015 a sbol:Component ; - sbol:description "Double terminator consisting of BBa_B0010 and BBa_B0012" ; - sbol:displayId "BBa_B0015" ; - sbol:hasFeature , ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :BBa_B0015_Sequence1 ; - sbol:name "BBa_B0015" ; - sbol:role SO:0000141 ; +:BBa_R0062 a sbol:Component; + sbol:description "Promoter (luxR & HSL regulated -- lux pR)"; + sbol:displayId "BBa_R0062"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :BBa_R0062_Sequence1; + sbol:name "lux pR"; + sbol:role SO:0000167; sbol:type SBO:0000251 . -:BBa_R0062_Sequence1 a sbol:Sequence ; - sbol:description "BBa_R0062 sequence" ; - sbol:displayId "BBa_R0062_Sequence1" ; - sbol:elements "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace <../igem> ; + + a sbol:Interaction; + sbol:displayId "Interaction3"; + sbol:hasParticipation , ; + sbol:type SBO:0000170 . + +:BBa_B0012_Sequence1 a sbol:Sequence; + sbol:description "BBa_B0012 sequence"; + sbol:displayId "BBa_B0012_Sequence1"; + sbol:elements "tcacactggctcaccttcgggtgggcctttctgcgtttata"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; sbol:name "Sequence1" . - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:hasLocation ; - sbol:instanceOf :BBa_B0010 ; + + a sbol:SubComponent; + sbol:displayId "SubComponent6"; + sbol:hasLocation ; + sbol:instanceOf :BBa_B0015; sbol:orientation SO:0001030 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent7" ; - sbol:hasLocation ; - sbol:instanceOf :BBa_R0062 ; - sbol:orientation SO:0001030 . +:BBa_B0034 a sbol:Component; + sbol:description "RBS based on Elowitz repressilator"; + sbol:displayId "BBa_B0034"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :BBa_B0034_Sequence1; + sbol:name "BBa_B0034"; + sbol:role SO:0000139; + sbol:type SBO:0000251 . -:BBa_F2620 a sbol:Component ; - sbol:description "PoPS Receiver" ; - sbol:displayId "BBa_F2620" ; - sbol:hasFeature , , , , , , ; - sbol:hasInteraction , , ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :BBa_F2620_Sequence1 ; - sbol:name "BBa_F2620" ; - sbol:role SO:0000704 ; - sbol:type SBO:0000251 . + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :BBa_C0062_protein . + + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000643 . + +:TetR_protein a sbol:Component; + sbol:description "TetR protein"; + sbol:displayId "TetR_protein"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :TetR_protein_Sequence1; + sbol:name "TetR"; + sbol:role GO:0003700; + sbol:type SBO:0000252 . - a sbol:Range ; - sbol:displayId "Range1" ; - sbol:end "847" ; - sbol:hasSequence :BBa_F2620_Sequence1 ; - sbol:orientation SO:0001030 ; + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "847"; + sbol:hasSequence :BBa_F2620_Sequence1; + sbol:orientation SO:0001030; sbol:start "67" . - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :BBa_C0062_protein . - -:BBa_C0062_protein_Sequence1 - a sbol:Sequence ; - sbol:description "BBa_C0062_protein sequence" ; - sbol:displayId "BBa_C0062_protein_Sequence1" ; - sbol:elements "NNNNNNNNNNN" ; - sbol:encoding EDAM:format_1208 ; - sbol:hasNamespace <../igem> ; +:BBa_B0010_Sequence1 a sbol:Sequence; + sbol:description "BBa_B0010 sequence"; + sbol:displayId "BBa_B0010_Sequence1"; + sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; sbol:name "Sequence1" . - - a sbol:Interaction ; - sbol:displayId "Interaction3" ; - sbol:hasParticipation , ; - sbol:type SBO:0000170 . - - - a sbol:Range ; - sbol:displayId "Range1" ; - sbol:end "121" ; - sbol:hasSequence :BBa_B0015_Sequence1 ; - sbol:orientation SO:0001030 ; - sbol:start "81" . +:BBa_R0062_Sequence1 a sbol:Sequence; + sbol:description "BBa_R0062 sequence"; + sbol:displayId "BBa_R0062_Sequence1"; + sbol:elements "acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . - - a sbol:SubComponent ; - sbol:displayId "SubComponent6" ; - sbol:hasLocation ; - sbol:instanceOf :BBa_B0015 ; + + a sbol:SubComponent; + sbol:displayId "SubComponent3"; + sbol:hasLocation ; + sbol:instanceOf :BBa_R0040; sbol:orientation SO:0001030 . -:BBa_B0034 a sbol:Component ; - sbol:description "RBS based on Elowitz repressilator" ; - sbol:displayId "BBa_B0034" ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :BBa_B0034_Sequence1 ; - sbol:name "BBa_B0034" ; - sbol:role SO:0000139 ; - sbol:type SBO:0000251 . + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000643 . -:BBa_R0062 a sbol:Component ; - sbol:description "Promoter (luxR & HSL regulated -- lux pR)" ; - sbol:displayId "BBa_R0062" ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :BBa_R0062_Sequence1 ; - sbol:name "lux pR" ; - sbol:role SO:0000167 ; +:BBa_B0015 a sbol:Component; + sbol:description "Double terminator consisting of BBa_B0010 and BBa_B0012"; + sbol:displayId "BBa_B0015"; + sbol:hasFeature , ; + sbol:hasNamespace <../igem>; + sbol:hasSequence :BBa_B0015_Sequence1; + sbol:name "BBa_B0015"; + sbol:role SO:0000141; sbol:type SBO:0000251 . - - a sbol:Range ; - sbol:displayId "Range1" ; - sbol:end "968" ; - sbol:hasSequence :BBa_F2620_Sequence1 ; - sbol:orientation SO:0001030 ; - sbol:start "848" . +:BBa_C0062_protein a sbol:Component; + sbol:description "LuxR protein"; + sbol:displayId "BBa_C0062_protein"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :BBa_C0062_protein_Sequence1; + sbol:name "LuxR"; + sbol:role GO:0003700; + sbol:type SBO:0000252 . -:BBa_R0040_Sequence1 a sbol:Sequence ; - sbol:description "BBa_R0040 sequence" ; - sbol:displayId "BBa_R0040_Sequence1" ; - sbol:elements "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace <../igem> ; - sbol:name "Sequence1" . +:BBa_B0010 a sbol:Component; + sbol:description "Transcriptional terminator consisting of a 64 bp stem-loop"; + sbol:displayId "BBa_B0010"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :BBa_B0010_Sequence1; + sbol:name "BBa_B0010"; + sbol:role SO:0000141; + sbol:type SBO:0000251 . - a sbol:Interaction ; - sbol:displayId "Interaction2" ; - sbol:hasParticipation , ; + a sbol:Interaction; + sbol:displayId "Interaction2"; + sbol:hasParticipation , ; sbol:type SBO:0000170 . -:BBa_C0062 a sbol:Component ; - sbol:description "luxR repressor/activator, (no LVA?)" ; - sbol:displayId "BBa_C0062" ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :BBa_C0062_Sequence1 ; - sbol:name "luxR" ; - sbol:role SO:0000316 ; +:BBa_F2620_Sequence1 a sbol:Sequence; + sbol:description "BBa_F2620 sequence"; + sbol:displayId "BBa_F2620_Sequence1"; + sbol:elements "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacaaagaggagaaaatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttataacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . + +:BBa_R0040 a sbol:Component; + sbol:description "TetR repressible promoter"; + sbol:displayId "BBa_R0040"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :BBa_R0040_Sequence1; + sbol:name "pTetR"; + sbol:role SO:0000167; sbol:type SBO:0000251 . diff --git a/SBOL3/combine2020/combine2020.jsonld b/SBOL3/combine2020/combine2020.jsonld index 42ed855..60fde31 100644 --- a/SBOL3/combine2020/combine2020.jsonld +++ b/SBOL3/combine2020/combine2020.jsonld @@ -1,42 +1,28 @@ { "@graph": [ { - "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1", - "sbol:hasParticipation": [ - { - "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2" - }, - { - "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1" - } - ], - "sbol:type": { - "@id": "SBO:0000589" - }, - "sbol:displayId": "Interaction1", - "@type": "sbol:Interaction" - }, - { - "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2", - "sbol:participant": { - "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent2" + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature1", + "sbol:orientation": { + "@id": "SO:0001030" }, - "sbol:role": { - "@id": "SBO:0000011" + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1" }, - "sbol:displayId": "Participation2", - "@type": "sbol:Participation" + "sbol:displayId": "SequenceFeature1", + "@type": "sbol:SequenceFeature" }, { - "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1", - "sbol:participant": { - "@id": "https://synbiohub.org/public/igem/i13504_system/ComponentReference1" + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1", + "sbol:orientation": { + "@id": "SO:0001030" }, - "sbol:role": { - "@id": "SBO:0000645" + "sbol:end": "18", + "sbol:start": "13", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" }, - "sbol:displayId": "Participation1", - "@type": "sbol:Participation" + "sbol:displayId": "Range1", + "@type": "sbol:Range" }, { "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1", @@ -66,117 +52,26 @@ "@type": "sbol:Sequence" }, { - "@id": "https://synbiohub.org/public/igem/interlab16device1", - "sbol:hasConstraint": { - "@id": "https://synbiohub.org/public/igem/interlab16device1/Constraint1" - }, - "sbol:hasFeature": [ - { - "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" - }, - { - "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" - }, - { - "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" - } - ], - "sbol:role": { - "@id": "SO:0000704" - }, - "sbol:hasNamespace": { - "@id": "https://synbiohub.org/public/igem" - }, - "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:displayId": "interlab16device1", - "@type": "sbol:Component" - }, - { - "@id": "https://synbiohub.org/public/igem/interlab16device1/Constraint1", - "sbol:object": { - "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" - }, - "sbol:subject": { - "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" - }, - "sbol:restriction": { - "@id": "sbol:meets" - }, - "sbol:displayId": "Constraint1", - "@type": "sbol:Constraint" - }, - { - "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1", - "sbol:inChildOf": { - "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2", + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1" }, - "sbol:refersTo": { - "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + "sbol:orientation": { + "@id": "SO:0001030" }, - "sbol:displayId": "ComponentReference1", - "@type": "sbol:ComponentReference" - }, - { - "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent2", "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/i13504_system" + "@id": "https://synbiohub.org/public/igem/E0040" }, "sbol:displayId": "SubComponent2", "@type": "sbol:SubComponent" }, { - "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1", - "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/j23101" - }, - "sbol:displayId": "SubComponent1", - "@type": "sbol:SubComponent" - }, - { - "@id": "https://synbiohub.org/public/igem/B0034_Sequence1", - "sbol:encoding": { - "@id": "EDAM:format_1207" - }, - "sbol:elements": "aaagaggagaaa", - "sbol:description": "B0034 sequence", - "sbol:name": "Sequence1", - "sbol:hasNamespace": { - "@id": "https://synbiohub.org/public/igem" - }, - "sbol:displayId": "B0034_Sequence1", - "@type": "sbol:Sequence" - }, - { - "@id": "https://synbiohub.org/public/igem/i13504_system/ComponentReference1", - "sbol:inChildOf": { - "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" - }, - "sbol:refersTo": { - "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2" - }, - "sbol:displayId": "ComponentReference1", - "@type": "sbol:ComponentReference" - }, - { - "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature1", - "sbol:orientation": { - "@id": "SO:0001030" - }, - "sbol:hasLocation": { - "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1" - }, - "sbol:displayId": "SequenceFeature1", - "@type": "sbol:SequenceFeature" - }, - { - "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1", + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1", "sbol:orientation": { "@id": "SO:0001030" }, - "sbol:end": "18", - "sbol:start": "13", + "sbol:end": "738", + "sbol:start": "19", "sbol:hasSequence": { "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" }, @@ -203,21 +98,39 @@ "@type": "sbol:Component" }, { - "@id": "https://synbiohub.org/public/igem/E0040_Sequence1", - "sbol:encoding": { - "@id": "EDAM:format_1207" - }, - "sbol:elements": "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa", - "sbol:description": "E0040 sequence", - "sbol:name": "Sequence1", + "@id": "https://synbiohub.org/public/igem/GFP_protein", + "sbol:description": "GFP", + "sbol:name": "GFP", "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" }, - "sbol:displayId": "E0040_Sequence1", - "@type": "sbol:Sequence" + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "GFP_protein", + "@type": "sbol:Component" }, { - "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent2", + "@id": "https://synbiohub.org/public/igem/i13504_system/ComponentReference1", + "sbol:inChildOf": { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + }, + "sbol:refersTo": { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/i13504" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent2", "sbol:instanceOf": { "@id": "https://synbiohub.org/public/igem/i13504_system" }, @@ -226,37 +139,51 @@ }, { "@id": "https://synbiohub.org/public/igem/i13504_system", - "sbol:hasNamespace": { - "@id": "https://synbiohub.org/public/igem" + "sbol:role": { + "@id": "SBO:0000289" }, + "@type": "sbol:Component", "sbol:hasFeature": [ { "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent2" }, { - "@id": "https://synbiohub.org/public/igem/i13504_system/ComponentReference1" + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" }, { - "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + "@id": "https://synbiohub.org/public/igem/i13504_system/ComponentReference1" } ], - "sbol:role": { - "@id": "SBO:0000289" + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" }, - "@type": "sbol:Component", + "sbol:displayId": "i13504_system", "sbol:hasInteraction": { "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1" }, "sbol:name": "i13504 system", - "sbol:displayId": "i13504_system", "sbol:type": { "@id": "SBO:0000241" } }, { - "@id": "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1", + "@id": "https://synbiohub.org/public/igem/interlab16device1/Constraint1", + "sbol:object": { + "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + }, + "sbol:subject": { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + }, + "sbol:restriction": { + "@id": "sbol:meets" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1", "sbol:inChildOf": { - "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent2" + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" }, "sbol:refersTo": { "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" @@ -265,37 +192,48 @@ "@type": "sbol:ComponentReference" }, { - "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1", + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1", "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/i13504" + "@id": "https://synbiohub.org/public/igem/j23101" }, "sbol:displayId": "SubComponent1", "@type": "sbol:SubComponent" }, { - "@id": "https://synbiohub.org/public/igem/B0015_Sequence1", - "sbol:encoding": { - "@id": "EDAM:format_1207" + "@id": "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1", + "sbol:inChildOf": { + "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent2" }, - "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", - "sbol:description": "B0015 sequence", - "sbol:name": "Sequence1", - "sbol:hasNamespace": { - "@id": "https://synbiohub.org/public/igem" + "sbol:refersTo": { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" }, - "sbol:displayId": "B0015_Sequence1", - "@type": "sbol:Sequence" + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" }, { - "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent1", + "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent2", "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/j23106" + "@id": "https://synbiohub.org/public/igem/i13504_system" }, - "sbol:displayId": "SubComponent1", + "sbol:displayId": "SubComponent2", "@type": "sbol:SubComponent" }, { - "@id": "https://synbiohub.org/public/igem/j23106", + "@id": "https://synbiohub.org/public/igem/interlab16device1", + "sbol:hasConstraint": { + "@id": "https://synbiohub.org/public/igem/interlab16device1/Constraint1" + }, + "sbol:hasFeature": [ + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + } + ], "sbol:role": { "@id": "SO:0000704" }, @@ -305,44 +243,53 @@ "sbol:type": { "@id": "SBO:0000251" }, - "sbol:displayId": "j23106", + "sbol:displayId": "interlab16device1", "@type": "sbol:Component" }, { - "@id": "https://synbiohub.org/public/igem/interlab16device2/Constraint1", - "sbol:object": { - "@id": "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1" - }, - "sbol:subject": { - "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" + "@id": "https://synbiohub.org/public/igem/E0040_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" }, - "sbol:restriction": { - "@id": "sbol:meets" + "sbol:elements": "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa", + "sbol:description": "E0040 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" }, - "sbol:displayId": "Constraint1", - "@type": "sbol:Constraint" + "sbol:displayId": "E0040_Sequence1", + "@type": "sbol:Sequence" }, { - "@id": "https://synbiohub.org/public/igem/GFP_protein", - "sbol:description": "GFP", - "sbol:name": "GFP", - "sbol:hasNamespace": { - "@id": "https://synbiohub.org/public/igem" + "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2", + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent2" }, - "sbol:type": { - "@id": "SBO:0000252" + "sbol:role": { + "@id": "SBO:0000011" }, - "sbol:displayId": "GFP_protein", - "@type": "sbol:Component" + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent2", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/GFP_protein" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" }, { "@id": "https://synbiohub.org/public/igem/i13504", + "sbol:role": { + "@id": "SO:0000804" + }, "sbol:hasFeature": [ { "@id": "https://synbiohub.org/public/igem/i13504/SubComponent3" }, { - "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature2" + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1" }, { "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature1" @@ -351,25 +298,22 @@ "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2" }, { - "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1" + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature2" } ], + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:description": "Screening plasmid intermediate", + "sbol:name": "i13504", "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" }, - "sbol:name": "i13504", "@type": "sbol:Component", + "sbol:displayId": "i13504", "sbol:hasSequence": { "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" - }, - "sbol:displayId": "i13504", - "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:role": { - "@id": "SO:0000804" - }, - "sbol:description": "Screening plasmid intermediate" + } }, { "@id": "https://synbiohub.org/public/igem/i13504/SubComponent3", @@ -386,57 +330,42 @@ "@type": "sbol:SubComponent" }, { - "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature2", - "sbol:orientation": { - "@id": "SO:0001030" - }, - "sbol:hasLocation": { - "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1" - }, - "sbol:displayId": "SequenceFeature2", - "@type": "sbol:SequenceFeature" - }, - { - "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2", + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1", "sbol:hasLocation": { - "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1" + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" }, "sbol:orientation": { "@id": "SO:0001030" }, "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/E0040" + "@id": "https://synbiohub.org/public/igem/B0034" }, - "sbol:displayId": "SubComponent2", + "sbol:displayId": "SubComponent1", "@type": "sbol:SubComponent" }, { - "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1", - "sbol:hasLocation": { - "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" - }, + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature2", "sbol:orientation": { "@id": "SO:0001030" }, - "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/B0034" + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1" }, - "sbol:displayId": "SubComponent1", - "@type": "sbol:SubComponent" + "sbol:displayId": "SequenceFeature2", + "@type": "sbol:SequenceFeature" }, { - "@id": "https://synbiohub.org/public/igem/j23101", - "sbol:role": { - "@id": "SO:0000704" - }, - "sbol:hasNamespace": { - "@id": "https://synbiohub.org/public/igem" + "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1", + "sbol:orientation": { + "@id": "SO:0001030" }, - "sbol:type": { - "@id": "SBO:0000251" + "sbol:end": "746", + "sbol:start": "739", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" }, - "sbol:displayId": "j23101", - "@type": "sbol:Component" + "sbol:displayId": "Range1", + "@type": "sbol:Range" }, { "@id": "https://synbiohub.org/public/igem/i13504/SubComponent3/Range1", @@ -471,44 +400,59 @@ "@type": "sbol:Component" }, { - "@id": "https://synbiohub.org/public/igem/B0034", - "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/B0034_Sequence1" - }, + "@id": "https://synbiohub.org/public/igem/j23101", "sbol:role": { - "@id": "SO:0000139" + "@id": "SO:0000704" }, - "sbol:description": "RBS (Elowitz 1999)", - "sbol:name": "rbs", "sbol:hasNamespace": { "@id": "https://synbiohub.org/public/igem" }, "sbol:type": { "@id": "SBO:0000251" }, - "sbol:displayId": "B0034", + "sbol:displayId": "j23101", "@type": "sbol:Component" }, { - "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent2", - "sbol:instanceOf": { - "@id": "https://synbiohub.org/public/igem/GFP_protein" + "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1", + "sbol:hasParticipation": [ + { + "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1" + } + ], + "sbol:type": { + "@id": "SBO:0000589" }, - "sbol:displayId": "SubComponent2", - "@type": "sbol:SubComponent" + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" }, { - "@id": "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1", - "sbol:orientation": { - "@id": "SO:0001030" + "@id": "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1", + "sbol:participant": { + "@id": "https://synbiohub.org/public/igem/i13504_system/ComponentReference1" }, - "sbol:end": "738", - "sbol:start": "19", - "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" + "sbol:role": { + "@id": "SBO:0000645" }, - "sbol:displayId": "Range1", - "@type": "sbol:Range" + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://synbiohub.org/public/igem/j23106", + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "j23106", + "@type": "sbol:Component" }, { "@id": "https://synbiohub.org/public/igem/interlab16device2", @@ -539,17 +483,73 @@ "@type": "sbol:Component" }, { - "@id": "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1", - "sbol:orientation": { - "@id": "SO:0001030" + "@id": "https://synbiohub.org/public/igem/interlab16device2/Constraint1", + "sbol:object": { + "@id": "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1" }, - "sbol:end": "746", - "sbol:start": "739", + "sbol:subject": { + "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" + }, + "sbol:restriction": { + "@id": "sbol:meets" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device2/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/j23106" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/B0034", "sbol:hasSequence": { - "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" + "@id": "https://synbiohub.org/public/igem/B0034_Sequence1" }, - "sbol:displayId": "Range1", - "@type": "sbol:Range" + "sbol:role": { + "@id": "SO:0000139" + }, + "sbol:description": "RBS (Elowitz 1999)", + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "B0034", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/B0034_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "aaagaggagaaa", + "sbol:description": "B0034 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "B0034_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/B0015_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", + "sbol:description": "B0015 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "B0015_Sequence1", + "@type": "sbol:Sequence" } ], "@context": { diff --git a/SBOL3/combine2020/combine2020.jsonld_expanded b/SBOL3/combine2020/combine2020.jsonld_expanded index 62d585e..3bded7a 100644 --- a/SBOL3/combine2020/combine2020.jsonld_expanded +++ b/SBOL3/combine2020/combine2020.jsonld_expanded @@ -1,635 +1 @@ -[ { - "@id" : "https://synbiohub.org/public/igem/B0015", - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/B0015_Sequence1" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000141" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "B0015 double terminator" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "terminator" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "B0015" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/B0015_Sequence1", - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1207" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "B0015 sequence" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "B0015_Sequence1" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/B0034", - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/B0034_Sequence1" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000139" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "RBS (Elowitz 1999)" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "rbs" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "B0034" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/B0034_Sequence1", - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1207" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "aaagaggagaaa" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "B0034 sequence" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "B0034_Sequence1" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/E0040", - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/E0040_Sequence1" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000316" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "gfp coding sequence" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "gfp" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "E0040" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/E0040_Sequence1", - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1207" - } ], - "http://sbols.org/v3#elements" : [ { - "@value" : "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "E0040 sequence" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "E0040_Sequence1" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/GFP_protein", - "http://sbols.org/v3#description" : [ { - "@value" : "GFP" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "GFP" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "GFP_protein" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504", - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent3" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature2" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature1" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent2" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "i13504" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_Sequence1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "i13504" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000804" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Screening plasmid intermediate" - } ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature1", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#hasLocation" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SequenceFeature1" - } ], - "@type" : [ "http://sbols.org/v3#SequenceFeature" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#end" : [ { - "@value" : "18" - } ], - "http://sbols.org/v3#start" : [ { - "@value" : "13" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_Sequence1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Range1" - } ], - "@type" : [ "http://sbols.org/v3#Range" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature2", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#hasLocation" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SequenceFeature2" - } ], - "@type" : [ "http://sbols.org/v3#SequenceFeature" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#end" : [ { - "@value" : "746" - } ], - "http://sbols.org/v3#start" : [ { - "@value" : "739" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_Sequence1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Range1" - } ], - "@type" : [ "http://sbols.org/v3#Range" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent1", - "http://sbols.org/v3#hasLocation" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" - } ], - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/B0034" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#end" : [ { - "@value" : "12" - } ], - "http://sbols.org/v3#start" : [ { - "@value" : "1" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_Sequence1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Range1" - } ], - "@type" : [ "http://sbols.org/v3#Range" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent2", - "http://sbols.org/v3#hasLocation" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1" - } ], - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/E0040" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#end" : [ { - "@value" : "738" - } ], - "http://sbols.org/v3#start" : [ { - "@value" : "19" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_Sequence1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Range1" - } ], - "@type" : [ "http://sbols.org/v3#Range" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent3", - "http://sbols.org/v3#hasLocation" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent3/Range1" - } ], - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/B0015" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent3" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent3/Range1", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#end" : [ { - "@value" : "826" - } ], - "http://sbols.org/v3#start" : [ { - "@value" : "747" - } ], - "http://sbols.org/v3#hasSequence" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_Sequence1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Range1" - } ], - "@type" : [ "http://sbols.org/v3#Range" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504_Sequence1", - "http://sbols.org/v3#elements" : [ { - "@value" : "aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" - } ], - "http://sbols.org/v3#encoding" : [ { - "@id" : "https://identifiers.org/edam:format_1207" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "i13504 sequence" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "Sequence1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "i13504_Sequence1" - } ], - "@type" : [ "http://sbols.org/v3#Sequence" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504_system", - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_system/SubComponent2" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/ComponentReference1" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000289" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#hasInteraction" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_system/Interaction1" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "i13504 system" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "i13504_system" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/ComponentReference1", - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" - } ], - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504/SubComponent2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference1" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/Interaction1", - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2" - }, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000589" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction1" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1", - "http://sbols.org/v3#participant" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_system/ComponentReference1" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000645" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2", - "http://sbols.org/v3#participant" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_system/SubComponent2" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000011" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/i13504_system/SubComponent2", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/GFP_protein" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/interlab16device1", - "http://sbols.org/v3#hasConstraint" : [ { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/Constraint1" - } ], - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000704" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "interlab16device1" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1", - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" - } ], - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference1" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/Constraint1", - "http://sbols.org/v3#object" : [ { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" - } ], - "http://sbols.org/v3#subject" : [ { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#meets" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint1" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/j23101" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent2", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_system" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/interlab16device2", - "http://sbols.org/v3#hasConstraint" : [ { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/Constraint1" - } ], - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent2" - }, { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000704" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "interlab16device2" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1", - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent2" - } ], - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference1" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/Constraint1", - "http://sbols.org/v3#object" : [ { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1" - } ], - "http://sbols.org/v3#subject" : [ { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#meets" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint1" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent1", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/j23106" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent2", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://synbiohub.org/public/igem/i13504_system" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://synbiohub.org/public/igem/j23101", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000704" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "j23101" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://synbiohub.org/public/igem/j23106", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000704" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://synbiohub.org/public/igem" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "j23106" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -} ] +{"@graph":[{"@id":"https://synbiohub.org/public/igem/i13504/SequenceFeature1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1"}],"http://sbols.org/v3#displayId":[{"@value":"SequenceFeature1"}],"@type":["http://sbols.org/v3#SequenceFeature"]},{"@id":"https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#end":[{"@value":"18"}],"http://sbols.org/v3#start":[{"@value":"13"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent1/Range1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#end":[{"@value":"12"}],"http://sbols.org/v3#start":[{"@value":"1"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1","http://sbols.org/v3#elements":[{"@value":"aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#description":[{"@value":"i13504 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"i13504_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent2","http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent2/Range1"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/E0040"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent2/Range1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#end":[{"@value":"738"}],"http://sbols.org/v3#start":[{"@value":"19"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/E0040","http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/E0040_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#description":[{"@value":"gfp coding sequence"}],"http://sbols.org/v3#name":[{"@value":"gfp"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"E0040"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/GFP_protein","http://sbols.org/v3#description":[{"@value":"GFP"}],"http://sbols.org/v3#name":[{"@value":"GFP"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#displayId":[{"@value":"GFP_protein"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/i13504_system/ComponentReference1","http://sbols.org/v3#inChildOf":[{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent1"}],"http://sbols.org/v3#refersTo":[{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference1"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/i13504"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/i13504_system"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/i13504_system","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000289"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent2"},{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent1"},{"@id":"https://synbiohub.org/public/igem/i13504_system/ComponentReference1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"i13504_system"}],"http://sbols.org/v3#hasInteraction":[{"@id":"https://synbiohub.org/public/igem/i13504_system/Interaction1"}],"http://sbols.org/v3#name":[{"@value":"i13504 system"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}]},{"@id":"https://synbiohub.org/public/igem/interlab16device1/Constraint1","http://sbols.org/v3#object":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/ComponentReference1"}],"http://sbols.org/v3#subject":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#meets"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint1"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://synbiohub.org/public/igem/interlab16device1/ComponentReference1","http://sbols.org/v3#inChildOf":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent2"}],"http://sbols.org/v3#refersTo":[{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference1"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/j23101"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/interlab16device2/ComponentReference1","http://sbols.org/v3#inChildOf":[{"@id":"https://synbiohub.org/public/igem/interlab16device2/SubComponent2"}],"http://sbols.org/v3#refersTo":[{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference1"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://synbiohub.org/public/igem/interlab16device2/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/i13504_system"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/interlab16device1","http://sbols.org/v3#hasConstraint":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/Constraint1"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/ComponentReference1"},{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent2"},{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"interlab16device1"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/E0040_Sequence1","http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa"}],"http://sbols.org/v3#description":[{"@value":"E0040 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"E0040_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2","http://sbols.org/v3#participant":[{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent2"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/GFP_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/i13504","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000804"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent3"},{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent1"},{"@id":"https://synbiohub.org/public/igem/i13504/SequenceFeature1"},{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent2"},{"@id":"https://synbiohub.org/public/igem/i13504/SequenceFeature2"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#description":[{"@value":"Screening plasmid intermediate"}],"http://sbols.org/v3#name":[{"@value":"i13504"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#displayId":[{"@value":"i13504"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1"}]},{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent3","http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent3/Range1"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/B0015"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent1","http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent1/Range1"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/B0034"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/i13504/SequenceFeature2","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1"}],"http://sbols.org/v3#displayId":[{"@value":"SequenceFeature2"}],"@type":["http://sbols.org/v3#SequenceFeature"]},{"@id":"https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#end":[{"@value":"746"}],"http://sbols.org/v3#start":[{"@value":"739"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent3/Range1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#end":[{"@value":"826"}],"http://sbols.org/v3#start":[{"@value":"747"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/B0015","http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/B0015_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#description":[{"@value":"B0015 double terminator"}],"http://sbols.org/v3#name":[{"@value":"terminator"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"B0015"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/j23101","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"j23101"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/i13504_system/Interaction1","http://sbols.org/v3#hasParticipation":[{"@id":"https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2"},{"@id":"https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction1"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1","http://sbols.org/v3#participant":[{"@id":"https://synbiohub.org/public/igem/i13504_system/ComponentReference1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000645"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://synbiohub.org/public/igem/j23106","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"j23106"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/interlab16device2","http://sbols.org/v3#hasConstraint":[{"@id":"https://synbiohub.org/public/igem/interlab16device2/Constraint1"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/interlab16device2/ComponentReference1"},{"@id":"https://synbiohub.org/public/igem/interlab16device2/SubComponent2"},{"@id":"https://synbiohub.org/public/igem/interlab16device2/SubComponent1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"interlab16device2"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/interlab16device2/Constraint1","http://sbols.org/v3#object":[{"@id":"https://synbiohub.org/public/igem/interlab16device2/ComponentReference1"}],"http://sbols.org/v3#subject":[{"@id":"https://synbiohub.org/public/igem/interlab16device2/SubComponent1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#meets"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint1"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://synbiohub.org/public/igem/interlab16device2/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/j23106"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/B0034","http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/B0034_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000139"}],"http://sbols.org/v3#description":[{"@value":"RBS (Elowitz 1999)"}],"http://sbols.org/v3#name":[{"@value":"rbs"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"B0034"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/B0034_Sequence1","http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"aaagaggagaaa"}],"http://sbols.org/v3#description":[{"@value":"B0034 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"B0034_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/B0015_Sequence1","http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"}],"http://sbols.org/v3#description":[{"@value":"B0015 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"B0015_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]}]} \ No newline at end of file diff --git a/SBOL3/combine2020/combine2020.nt b/SBOL3/combine2020/combine2020.nt index 9aa745d..8f3faf5 100644 --- a/SBOL3/combine2020/combine2020.nt +++ b/SBOL3/combine2020/combine2020.nt @@ -1,14 +1,40 @@ - . - . - . - "Interaction1" . - . + . + . + "SequenceFeature1" . + . . "12" . "1" . . "Range1" . . + . + . + . + "SubComponent2" . + . + "GFP" . + "GFP" . + . + . + "GFP_protein" . + . + . + . + "ComponentReference1" . + . + . + "SubComponent2" . + . + . + . + . + "Constraint1" . + . + . + . + "ComponentReference1" . + . . . . @@ -18,27 +44,6 @@ . "interlab16device1" . . - . - "aaagaggagaaa" . - "B0034 sequence" . - "Sequence1" . - . - "B0034_Sequence1" . - . - . - . - "Participation1" . - . - . - . - "SequenceFeature1" . - . - . - "18" . - "13" . - . - "Range1" . - . . . "gfp coding sequence" . @@ -47,81 +52,85 @@ . "E0040" . . + . + . + "Participation2" . + . . "SubComponent2" . . - . - . - "ComponentReference1" . - . - . - "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . - "B0015 sequence" . - "Sequence1" . - . - "B0015_Sequence1" . - . - . - "SubComponent1" . - . - . - . - . - "Constraint1" . - . - "GFP" . - "GFP" . - . - . - "GFP_protein" . - . + . . - . - "i13504" . - . - . - . - . - . . - "i13504" . + . . - . "Screening plasmid intermediate" . + . + "i13504" . + . + . + "i13504" . + . + . + . + "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" . + "E0040 sequence" . + "Sequence1" . + . + "E0040_Sequence1" . + . + . + "746" . + "739" . + . + "Range1" . + . + . + "SubComponent1" . + . + . + . + "SequenceFeature2" . + . + . + "738" . + "19" . + . + "Range1" . + . + . + . + . + "SubComponent3" . + . . . . "j23101" . . + . + . + . + "Interaction1" . + . . . . "j23106" . . - . - . - "ComponentReference1" . - . - . - . - . - "Constraint1" . - . - . - "SubComponent2" . - . - "aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . - . - "i13504 sequence" . - "Sequence1" . - . - "i13504_Sequence1" . - . - . - . - . - "SubComponent3" . - . + . + . + . + . + . + . + . + "interlab16device2" . + . + . + . + "ComponentReference1" . + . . . "RBS (Elowitz 1999)" . @@ -130,86 +139,77 @@ . "B0034" . . - . - . + . + . + . + "SubComponent1" . + . + . + "SubComponent1" . + . + . + . + "B0015 double terminator" . + "terminator" . + . + . + "B0015" . + . . . + . + . + "i13504_system" . + . . . "i13504 system" . - . - "i13504_system" . . + . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + "B0015 sequence" . + "Sequence1" . + . + "B0015_Sequence1" . + . + "aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + . + "i13504 sequence" . + "Sequence1" . + . + "i13504_Sequence1" . + . + . + "SubComponent2" . + . + . + . + "Participation1" . + . + . + "aaagaggagaaa" . + "B0034 sequence" . + "Sequence1" . + . + "B0034_Sequence1" . + . . "826" . "747" . . "Range1" . . - . - . - "B0015 double terminator" . - "terminator" . - . - . - "B0015" . - . - . - "SubComponent2" . - . - . - . - . - "SubComponent2" . - . - . - "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" . - "E0040 sequence" . - "Sequence1" . - . - "E0040_Sequence1" . - . - . - "SubComponent1" . - . - . - "738" . - "19" . - . - "Range1" . - . - . - . - "ComponentReference1" . - . - . - "SubComponent1" . - . - . - . - . - . - . - . - . - "interlab16device2" . - . - . - "746" . - "739" . - . - "Range1" . - . - . - . - . - "SubComponent1" . - . - . - . - "Participation2" . - . - . - . - "SequenceFeature2" . - . + . + "SubComponent1" . + . + . + . + . + "Constraint1" . + . + . + "18" . + "13" . + . + "Range1" . + . diff --git a/SBOL3/combine2020/combine2020.rdf b/SBOL3/combine2020/combine2020.rdf index 341fa13..1ef0695 100644 --- a/SBOL3/combine2020/combine2020.rdf +++ b/SBOL3/combine2020/combine2020.rdf @@ -21,80 +21,21 @@ E0040 - + - j23106 + j23101 - + + GFP + GFP - - - - - - SubComponent2 - - - - - - - - - - - SubComponent1 - - - - - - - - 738 - 19 - - - - Range1 - - - - - SubComponent2 - - - ComponentReference1 - - - - - - - - - Participation2 - - - - - - - Participation1 - - - - Interaction1 - - - i13504 system - - i13504_system - + + GFP_protein + @@ -115,28 +56,26 @@ SubComponent3 - - i13504 - - + - + - 746 - 739 + 12 + 1 Range1 - SequenceFeature2 - + + + + + SubComponent1 + - - - @@ -154,14 +93,15 @@ SequenceFeature1 - + + Screening plasmid intermediate - + - + - 12 - 1 + 738 + 19 @@ -169,27 +109,79 @@ - - - - SubComponent1 + + SubComponent2 + i13504 + i13504 - - - Screening plasmid intermediate - - + + + + + + + 746 + 739 + + + + Range1 + + + SequenceFeature2 + + - + - - B0015 double terminator - terminator + + + + + + + SubComponent2 + + - - B0015 + i13504_system + + + + SubComponent1 + + + + + + + ComponentReference1 + + + + + + + + + Participation2 + + + + + + + Participation1 + + + + Interaction1 + + + i13504 system + @@ -208,9 +200,7 @@ - - - + SubComponent1 @@ -226,6 +216,12 @@ interlab16device1 + + + + + j23106 + @@ -270,26 +266,24 @@ interlab16device2 - - + + + + + + B0015 double terminator + terminator - j23101 - - - GFP - GFP - - - GFP_protein + B0015 - - aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc + - i13504 sequence + aaagaggagaaa + B0034 sequence Sequence1 - i13504_Sequence1 + B0034_Sequence1 @@ -307,12 +301,12 @@ E0040_Sequence1 - + + aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc - aaagaggagaaa - B0034 sequence + i13504 sequence Sequence1 - B0034_Sequence1 + i13504_Sequence1 diff --git a/SBOL3/combine2020/combine2020.rj b/SBOL3/combine2020/combine2020.rj index 7336727..9563231 100644 --- a/SBOL3/combine2020/combine2020.rj +++ b/SBOL3/combine2020/combine2020.rj @@ -1,31 +1,8 @@ { - "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "ComponentReference1" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" - } - ] , - "http://sbols.org/v3#inChildOf" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent2" - } - ] , - "http://sbols.org/v3#refersTo" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" - } - ] - } - , - "https://synbiohub.org/public/igem/j23106" : { + "https://synbiohub.org/public/igem/j23101" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "j23106" + "value" : "j23101" } ] , "http://sbols.org/v3#role" : [ { @@ -33,11 +10,6 @@ "value" : "https://identifiers.org/SO:0000704" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" - } - ] , "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , "value" : "https://synbiohub.org/public/igem" @@ -46,67 +18,57 @@ "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" - } - ] - } - , - "https://synbiohub.org/public/igem/i13504_Sequence1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "i13504_Sequence1" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "value" : "http://sbols.org/v3#Component" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + ] + } + , + "https://synbiohub.org/public/igem/i13504/SequenceFeature1" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" - } - ] , - "http://sbols.org/v3#elements" : [ { - "type" : "literal" , - "value" : "aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Sequence1" + "value" : "SequenceFeature1" } ] , - "http://sbols.org/v3#encoding" : [ { + "http://sbols.org/v3#hasLocation" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" + "value" : "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "i13504 sequence" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SequenceFeature" } ] } , "https://synbiohub.org/public/igem/i13504/SequenceFeature2" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "SequenceFeature2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#SequenceFeature" - } - ] , "http://sbols.org/v3#hasLocation" : [ { "type" : "uri" , "value" : "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "http://sbols.org/v3#SequenceFeature" } ] } @@ -117,14 +79,14 @@ "value" : "ComponentReference1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#inChildOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" + "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" } ] , - "http://sbols.org/v3#inChildOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + "value" : "http://sbols.org/v3#ComponentReference" } ] , "http://sbols.org/v3#refersTo" : [ { @@ -134,25 +96,20 @@ ] } , - "https://synbiohub.org/public/igem/B0015" : { + "https://synbiohub.org/public/igem/E0040" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "B0015" + "value" : "E0040" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000141" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000316" } ] , - "http://sbols.org/v3#hasSequence" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/B0015_Sequence1" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "gfp coding sequence" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -160,83 +117,68 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "terminator" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "B0015 double terminator" + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/E0040_Sequence1" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" - } - ] - } - , - "https://synbiohub.org/public/igem/interlab16device1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "interlab16device1" } ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0000704" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "gfp" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Component" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + ] + } + , + "https://synbiohub.org/public/igem/i13504" : { + "http://sbols.org/v3#hasFeature" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "value" : "https://synbiohub.org/public/igem/i13504/SubComponent1" } - ] , - "http://sbols.org/v3#hasConstraint" : [ { + , { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device1/Constraint1" + "value" : "https://synbiohub.org/public/igem/i13504/SubComponent3" } - ] , - "http://sbols.org/v3#hasFeature" : [ { + , { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + "value" : "https://synbiohub.org/public/igem/i13504/SubComponent2" } , { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + "value" : "https://synbiohub.org/public/igem/i13504/SequenceFeature1" } , { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" + "value" : "https://synbiohub.org/public/igem/i13504/SequenceFeature2" } ] , - "http://sbols.org/v3#type" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" - } - ] - } - , - "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Range1" + "value" : "i13504" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Range" + "value" : "https://identifiers.org/SO:0000804" } ] , - "http://sbols.org/v3#start" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "13" + "value" : "Screening plasmid intermediate" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" } ] , "http://sbols.org/v3#hasSequence" : [ { @@ -244,264 +186,284 @@ "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#end" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "18" + "value" : "i13504" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" : { + "https://synbiohub.org/public/igem/E0040_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "E0040_Sequence1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" } ] , - "http://sbols.org/v3#instanceOf" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system" - } - ] - } - , - "https://synbiohub.org/public/igem/i13504_system/SubComponent1" : { - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "SubComponent1" + "value" : "E0040 sequence" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504" + "value" : "http://sbols.org/v3#Sequence" } ] } , - "https://synbiohub.org/public/igem/interlab16device2/Constraint1" : { + "https://synbiohub.org/public/igem/i13504_system" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_system/ComponentReference1" + } + , { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent2" + } + , { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Constraint1" + "value" : "i13504_system" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" + "value" : "https://identifiers.org/SBO:0000289" } ] , - "http://sbols.org/v3#subject" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" + "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#restriction" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#meets" + "value" : "https://identifiers.org/SBO:0000241" } ] , - "http://sbols.org/v3#object" : [ { + "http://sbols.org/v3#hasInteraction" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1" + "value" : "https://synbiohub.org/public/igem/i13504_system/Interaction1" } - ] - } - , - "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Range1" + "value" : "i13504 system" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Range" + "value" : "http://sbols.org/v3#Component" } - ] , - "http://sbols.org/v3#start" : [ { + ] + } + , + "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" : { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "739" + "value" : "ComponentReference1" } ] , - "http://sbols.org/v3#hasSequence" : [ { + "http://sbols.org/v3#inChildOf" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" + "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "http://sbols.org/v3#ComponentReference" } ] , - "http://sbols.org/v3#end" : [ { - "type" : "literal" , - "value" : "746" + "http://sbols.org/v3#refersTo" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" } ] } , - "https://synbiohub.org/public/igem/i13504/SubComponent2" : { + "https://synbiohub.org/public/igem/B0034" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "B0034" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SO:0000139" } ] , - "http://sbols.org/v3#hasLocation" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "RBS (Elowitz 1999)" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/E0040" + "value" : "https://synbiohub.org/public/igem/B0034_Sequence1" } - ] - } - , - "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1" : { - "http://sbols.org/v3#participant" : [ { + ] , + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system/ComponentReference1" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Participation1" - } - ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000645" + "value" : "rbs" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/B0015_Sequence1" : { + "https://synbiohub.org/public/igem/interlab16device1/Constraint1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "B0015_Sequence1" + "value" : "Constraint1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#restriction" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" - } - ] , - "http://sbols.org/v3#elements" : [ { - "type" : "literal" , - "value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "Sequence1" + "value" : "http://sbols.org/v3#meets" } ] , - "http://sbols.org/v3#encoding" : [ { + "http://sbols.org/v3#object" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" + "value" : "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "B0015 sequence" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Constraint" } ] } , - "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" : { + "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Range1" + "value" : "SubComponent2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Range" + "value" : "https://synbiohub.org/public/igem/i13504_system" } ] , - "http://sbols.org/v3#start" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1" : { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "1" + "value" : "Participation1" } ] , - "http://sbols.org/v3#hasSequence" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" + "value" : "https://identifiers.org/SBO:0000645" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://synbiohub.org/public/igem/i13504_system/ComponentReference1" } ] , - "http://sbols.org/v3#end" : [ { - "type" : "literal" , - "value" : "12" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" : { + "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "SubComponent1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://synbiohub.org/public/igem/j23101" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/j23106" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://synbiohub.org/public/igem/B0034_Sequence1" : { + "https://synbiohub.org/public/igem/i13504_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "B0034_Sequence1" + "value" : "i13504_Sequence1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "i13504 sequence" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -509,169 +471,169 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#elements" : [ { - "type" : "literal" , - "value" : "aaagaggagaaa" - } - ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , "value" : "Sequence1" } ] , - "http://sbols.org/v3#encoding" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "B0034 sequence" + "value" : "http://sbols.org/v3#Sequence" } ] } , - "https://synbiohub.org/public/igem/j23101" : { + "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "j23101" + "value" : "Participation2" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000704" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SBO:0000011" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent2" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://synbiohub.org/public/igem/E0040" : { + "https://synbiohub.org/public/igem/B0015" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "E0040" + "value" : "B0015" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000316" + "value" : "https://identifiers.org/SO:0000141" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "B0015 double terminator" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://synbiohub.org/public/igem" } ] , "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/E0040_Sequence1" + "value" : "https://synbiohub.org/public/igem/B0015_Sequence1" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "value" : "https://identifiers.org/SBO:0000251" } ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "gfp" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "gfp coding sequence" + "value" : "terminator" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/i13504/SequenceFeature1" : { + "https://synbiohub.org/public/igem/interlab16device2/Constraint1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SequenceFeature1" + "value" : "Constraint1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SequenceFeature" + "value" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" } ] , - "http://sbols.org/v3#hasLocation" : [ { + "http://sbols.org/v3#restriction" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1" + "value" : "http://sbols.org/v3#meets" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#object" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Constraint" } ] } , - "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1" : { + "https://synbiohub.org/public/igem/B0034_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Range1" + "value" : "B0034_Sequence1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Range" + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "aaagaggagaaa" } ] , - "http://sbols.org/v3#start" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "19" + "value" : "B0034 sequence" } ] , - "http://sbols.org/v3#hasSequence" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" + "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#orientation" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" } ] , - "http://sbols.org/v3#end" : [ { - "type" : "literal" , - "value" : "738" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" } ] } , - "https://synbiohub.org/public/igem/i13504_system" : { + "https://synbiohub.org/public/igem/B0015_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "i13504_system" + "value" : "B0015_Sequence1" } ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000289" + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "B0015 sequence" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -679,32 +641,14 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#hasFeature" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system/ComponentReference1" - } - , { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent2" - } - , { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" - } - ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "i13504 system" - } - ] , - "http://sbols.org/v3#hasInteraction" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system/Interaction1" + "value" : "Sequence1" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "http://sbols.org/v3#Sequence" } ] } @@ -715,283 +659,329 @@ "value" : "Interaction1" } ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000589" + } + ] , "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2" + "value" : "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1" } , { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation1" + "value" : "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Interaction" - } - ] , - "http://sbols.org/v3#type" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000589" } ] } , - "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" : { + "https://synbiohub.org/public/igem/GFP_protein" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent1" + "value" : "GFP_protein" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "GFP" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/j23101" - } - ] - } - , - "https://synbiohub.org/public/igem/B0034" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "B0034" + "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000139" + "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "GFP" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Component" } - ] , - "http://sbols.org/v3#hasSequence" : [ { + ] + } + , + "https://synbiohub.org/public/igem/i13504/SubComponent3/Range1" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/B0034_Sequence1" + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#hasNamespace" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "826" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "rbs" + "value" : "Range1" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#start" : [ { "type" : "literal" , - "value" : "RBS (Elowitz 1999)" + "value" : "747" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Range" } ] } , - "https://synbiohub.org/public/igem/E0040_Sequence1" : { + "https://synbiohub.org/public/igem/i13504_system/SubComponent2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "E0040_Sequence1" + "value" : "SubComponent2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Sequence" + "value" : "https://synbiohub.org/public/igem/GFP_protein" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" - } - ] , - "http://sbols.org/v3#elements" : [ { - "type" : "literal" , - "value" : "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" + "value" : "http://sbols.org/v3#SubComponent" } - ] , - "http://sbols.org/v3#name" : [ { + ] + } + , + "https://synbiohub.org/public/igem/i13504_system/SubComponent1" : { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Sequence1" + "value" : "SubComponent1" } ] , - "http://sbols.org/v3#encoding" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_1207" + "value" : "https://synbiohub.org/public/igem/i13504" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "E0040 sequence" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" : { + "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "738" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ComponentReference1" + "value" : "Range1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" + "http://sbols.org/v3#start" : [ { + "type" : "literal" , + "value" : "19" } ] , - "http://sbols.org/v3#inChildOf" : [ { + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" + "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" } ] , - "http://sbols.org/v3#refersTo" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + "value" : "http://sbols.org/v3#Range" } ] } , - "https://synbiohub.org/public/igem/interlab16device2" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "interlab16device2" + "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0000704" + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "12" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Range1" } ] , - "http://sbols.org/v3#hasNamespace" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem" + "http://sbols.org/v3#start" : [ { + "type" : "literal" , + "value" : "1" } ] , - "http://sbols.org/v3#hasConstraint" : [ { + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device2/Constraint1" + "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" } ] , - "http://sbols.org/v3#hasFeature" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1" + "value" : "http://sbols.org/v3#Range" } - , { + ] + } + , + "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ComponentReference1" + } + ] , + "http://sbols.org/v3#inChildOf" : [ { "type" : "uri" , "value" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent2" } - , { + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" + "value" : "http://sbols.org/v3#ComponentReference" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#refersTo" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" } ] } , - "https://synbiohub.org/public/igem/interlab16device1/Constraint1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "Constraint1" + "https://synbiohub.org/public/igem/i13504/SubComponent1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" } ] , - "http://sbols.org/v3#subject" : [ { + "http://sbols.org/v3#hasLocation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + "value" : "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" } ] , - "http://sbols.org/v3#restriction" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#meets" + "value" : "https://synbiohub.org/public/igem/B0034" } ] , - "http://sbols.org/v3#object" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://synbiohub.org/public/igem/i13504/SubComponent3/Range1" : { + "https://synbiohub.org/public/igem/interlab16device1" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + } + , { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" + } + , { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Range1" + "value" : "interlab16device1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Range" + "value" : "https://identifiers.org/SO:0000704" } ] , - "http://sbols.org/v3#start" : [ { - "type" : "literal" , - "value" : "747" + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#hasSequence" : [ { + "http://sbols.org/v3#hasConstraint" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" + "value" : "https://synbiohub.org/public/igem/interlab16device1/Constraint1" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#end" : [ { - "type" : "literal" , - "value" : "826" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/i13504_system/SubComponent2" : { + "https://synbiohub.org/public/igem/i13504/SubComponent3" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "SubComponent3" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasLocation" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://synbiohub.org/public/igem/i13504/SubComponent3/Range1" } ] , "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/GFP_protein" + "value" : "https://synbiohub.org/public/igem/B0015" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://synbiohub.org/public/igem/GFP_protein" : { + "https://synbiohub.org/public/igem/j23106" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "GFP_protein" + "value" : "j23106" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000704" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -999,116 +989,119 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "GFP" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "GFP" + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://synbiohub.org/public/igem/i13504/SubComponent3" : { + "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent3" + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/j23106" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504/SubComponent2" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent2" } ] , "http://sbols.org/v3#hasLocation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504/SubComponent3/Range1" + "value" : "https://synbiohub.org/public/igem/i13504/SubComponent2/Range1" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://synbiohub.org/public/igem/E0040" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/B0015" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://synbiohub.org/public/igem/i13504_system/Interaction1/Participation2" : { - "http://sbols.org/v3#participant" : [ { + "https://synbiohub.org/public/igem/i13504/SequenceFeature1/Range1" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent2" + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "18" } ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation2" + "value" : "Range1" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#start" : [ { + "type" : "literal" , + "value" : "13" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000011" + "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Range" } ] } , - "https://synbiohub.org/public/igem/i13504/SubComponent1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "SubComponent1" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "https://synbiohub.org/public/igem/interlab16device2" : { + "http://sbols.org/v3#hasFeature" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://synbiohub.org/public/igem/interlab16device2/ComponentReference1" } - ] , - "http://sbols.org/v3#hasLocation" : [ { + , { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" + "value" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent1" } - ] , - "http://sbols.org/v3#orientation" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://synbiohub.org/public/igem/interlab16device2/SubComponent2" } ] , - "http://sbols.org/v3#instanceOf" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/B0034" - } - ] - } - , - "https://synbiohub.org/public/igem/i13504" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "i13504" + "value" : "interlab16device2" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000804" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000704" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -1116,45 +1109,52 @@ "value" : "https://synbiohub.org/public/igem" } ] , - "http://sbols.org/v3#hasSequence" : [ { + "http://sbols.org/v3#hasConstraint" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" + "value" : "https://synbiohub.org/public/igem/interlab16device2/Constraint1" } ] , - "http://sbols.org/v3#hasFeature" : [ { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504/SequenceFeature2" - } - , { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504/SubComponent3" + "value" : "https://identifiers.org/SBO:0000251" } - , { + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504/SequenceFeature1" + "value" : "http://sbols.org/v3#Component" } - , { + ] + } + , + "https://synbiohub.org/public/igem/i13504/SequenceFeature2/Range1" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504/SubComponent2" + "value" : "https://identifiers.org/SO:0001030" } - , { - "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504/SubComponent1" + ] , + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "746" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "i13504" + "value" : "Range1" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#start" : [ { "type" : "literal" , - "value" : "Screening plasmid intermediate" + "value" : "739" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#hasSequence" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Range" } ] } @@ -1165,14 +1165,14 @@ "value" : "SubComponent2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://synbiohub.org/public/igem/i13504_system" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://synbiohub.org/public/igem/i13504_system" + "value" : "http://sbols.org/v3#SubComponent" } ] } diff --git a/SBOL3/combine2020/combine2020.ttl b/SBOL3/combine2020/combine2020.ttl index 883ec57..d8c95ff 100644 --- a/SBOL3/combine2020/combine2020.ttl +++ b/SBOL3/combine2020/combine2020.ttl @@ -1,276 +1,276 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: - - a sbol:Interaction ; - sbol:displayId "Interaction1" ; - sbol:hasParticipation , ; - sbol:type SBO:0000589 . + + a sbol:SequenceFeature; + sbol:displayId "SequenceFeature1"; + sbol:hasLocation ; + sbol:orientation SO:0001030 . - a sbol:Range ; - sbol:displayId "Range1" ; - sbol:end "12" ; - sbol:hasSequence :i13504_Sequence1 ; - sbol:orientation SO:0001030 ; + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "12"; + sbol:hasSequence :i13504_Sequence1; + sbol:orientation SO:0001030; sbol:start "1" . -:interlab16device1 a sbol:Component ; - sbol:displayId "interlab16device1" ; - sbol:hasConstraint ; - sbol:hasFeature , , ; - sbol:hasNamespace <../igem> ; - sbol:role SO:0000704 ; - sbol:type SBO:0000251 . - -:B0034_Sequence1 a sbol:Sequence ; - sbol:description "B0034 sequence" ; - sbol:displayId "B0034_Sequence1" ; - sbol:elements "aaagaggagaaa" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace <../igem> ; - sbol:name "Sequence1" . - - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000645 . - - - a sbol:SequenceFeature ; - sbol:displayId "SequenceFeature1" ; - sbol:hasLocation ; + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:hasLocation ; + sbol:instanceOf :E0040; sbol:orientation SO:0001030 . - - a sbol:Range ; - sbol:displayId "Range1" ; - sbol:end "18" ; - sbol:hasSequence :i13504_Sequence1 ; - sbol:orientation SO:0001030 ; - sbol:start "13" . +:GFP_protein a sbol:Component; + sbol:description "GFP"; + sbol:displayId "GFP_protein"; + sbol:hasNamespace <../igem>; + sbol:name "GFP"; + sbol:type SBO:0000252 . -:E0040 a sbol:Component ; - sbol:description "gfp coding sequence" ; - sbol:displayId "E0040" ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :E0040_Sequence1 ; - sbol:name "gfp" ; - sbol:role SO:0000316 ; - sbol:type SBO:0000251 . + + a sbol:ComponentReference; + sbol:displayId "ComponentReference1"; + sbol:inChildOf ; + sbol:refersTo . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; sbol:instanceOf :i13504_system . + + a sbol:Constraint; + sbol:displayId "Constraint1"; + sbol:object ; + sbol:restriction sbol:meets; + sbol:subject . + - a sbol:ComponentReference ; - sbol:displayId "ComponentReference1" ; - sbol:inChildOf ; + a sbol:ComponentReference; + sbol:displayId "ComponentReference1"; + sbol:inChildOf ; sbol:refersTo . -:B0015_Sequence1 a sbol:Sequence ; - sbol:description "B0015 sequence" ; - sbol:displayId "B0015_Sequence1" ; - sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace <../igem> ; - sbol:name "Sequence1" . - - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :j23106 . +:interlab16device1 a sbol:Component; + sbol:displayId "interlab16device1"; + sbol:hasConstraint ; + sbol:hasFeature , , ; + sbol:hasNamespace <../igem>; + sbol:role SO:0000704; + sbol:type SBO:0000251 . - - a sbol:Constraint ; - sbol:displayId "Constraint1" ; - sbol:object ; - sbol:restriction sbol:meets ; - sbol:subject . +:E0040 a sbol:Component; + sbol:description "gfp coding sequence"; + sbol:displayId "E0040"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :E0040_Sequence1; + sbol:name "gfp"; + sbol:role SO:0000316; + sbol:type SBO:0000251 . -:GFP_protein a sbol:Component ; - sbol:description "GFP" ; - sbol:displayId "GFP_protein" ; - sbol:hasNamespace <../igem> ; - sbol:name "GFP" ; - sbol:type SBO:0000252 . + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000011 . -:i13504 a sbol:Component ; - sbol:description "Screening plasmid intermediate" ; - sbol:displayId "i13504" ; - sbol:hasFeature , , , , ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :i13504_Sequence1 ; - sbol:name "i13504" ; - sbol:role SO:0000804 ; - sbol:type SBO:0000251 . + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :i13504_system . -:j23101 a sbol:Component ; - sbol:displayId "j23101" ; - sbol:hasNamespace <../igem> ; - sbol:role SO:0000704 ; +:i13504 a sbol:Component; + sbol:description "Screening plasmid intermediate"; + sbol:displayId "i13504"; + sbol:hasFeature , , , , ; + sbol:hasNamespace <../igem>; + sbol:hasSequence :i13504_Sequence1; + sbol:name "i13504"; + sbol:role SO:0000804; sbol:type SBO:0000251 . -:j23106 a sbol:Component ; - sbol:displayId "j23106" ; - sbol:hasNamespace <../igem> ; - sbol:role SO:0000704 ; - sbol:type SBO:0000251 . +:E0040_Sequence1 a sbol:Sequence; + sbol:description "E0040 sequence"; + sbol:displayId "E0040_Sequence1"; + sbol:elements "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . - - a sbol:ComponentReference ; - sbol:displayId "ComponentReference1" ; - sbol:inChildOf ; - sbol:refersTo . + + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "746"; + sbol:hasSequence :i13504_Sequence1; + sbol:orientation SO:0001030; + sbol:start "739" . - - a sbol:Constraint ; - sbol:displayId "Constraint1" ; - sbol:object ; - sbol:restriction sbol:meets ; - sbol:subject . + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :i13504 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :i13504_system . + + a sbol:SequenceFeature; + sbol:displayId "SequenceFeature2"; + sbol:hasLocation ; + sbol:orientation SO:0001030 . -:i13504_Sequence1 a sbol:Sequence ; - sbol:description "i13504 sequence" ; - sbol:displayId "i13504_Sequence1" ; - sbol:elements "aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace <../igem> ; - sbol:name "Sequence1" . + + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "738"; + sbol:hasSequence :i13504_Sequence1; + sbol:orientation SO:0001030; + sbol:start "19" . - a sbol:SubComponent ; - sbol:displayId "SubComponent3" ; - sbol:hasLocation ; - sbol:instanceOf :B0015 ; + a sbol:SubComponent; + sbol:displayId "SubComponent3"; + sbol:hasLocation ; + sbol:instanceOf :B0015; sbol:orientation SO:0001030 . -:B0034 a sbol:Component ; - sbol:description "RBS (Elowitz 1999)" ; - sbol:displayId "B0034" ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :B0034_Sequence1 ; - sbol:name "rbs" ; - sbol:role SO:0000139 ; +:j23101 a sbol:Component; + sbol:displayId "j23101"; + sbol:hasNamespace <../igem>; + sbol:role SO:0000704; sbol:type SBO:0000251 . -:i13504_system a sbol:Component ; - sbol:displayId "i13504_system" ; - sbol:hasFeature , , ; - sbol:hasInteraction ; - sbol:hasNamespace <../igem> ; - sbol:name "i13504 system" ; - sbol:role SBO:0000289 ; - sbol:type SBO:0000241 . - - - a sbol:Range ; - sbol:displayId "Range1" ; - sbol:end "826" ; - sbol:hasSequence :i13504_Sequence1 ; - sbol:orientation SO:0001030 ; - sbol:start "747" . + + a sbol:Interaction; + sbol:displayId "Interaction1"; + sbol:hasParticipation , ; + sbol:type SBO:0000589 . -:B0015 a sbol:Component ; - sbol:description "B0015 double terminator" ; - sbol:displayId "B0015" ; - sbol:hasNamespace <../igem> ; - sbol:hasSequence :B0015_Sequence1 ; - sbol:name "terminator" ; - sbol:role SO:0000141 ; +:j23106 a sbol:Component; + sbol:displayId "j23106"; + sbol:hasNamespace <../igem>; + sbol:role SO:0000704; sbol:type SBO:0000251 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :GFP_protein . +:interlab16device2 a sbol:Component; + sbol:displayId "interlab16device2"; + sbol:hasConstraint ; + sbol:hasFeature , , ; + sbol:hasNamespace <../igem>; + sbol:role SO:0000704; + sbol:type SBO:0000251 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:hasLocation ; - sbol:instanceOf :E0040 ; - sbol:orientation SO:0001030 . + + a sbol:ComponentReference; + sbol:displayId "ComponentReference1"; + sbol:inChildOf ; + sbol:refersTo . -:E0040_Sequence1 a sbol:Sequence ; - sbol:description "E0040 sequence" ; - sbol:displayId "E0040_Sequence1" ; - sbol:elements "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" ; - sbol:encoding EDAM:format_1207 ; - sbol:hasNamespace <../igem> ; - sbol:name "Sequence1" . +:B0034 a sbol:Component; + sbol:description "RBS (Elowitz 1999)"; + sbol:displayId "B0034"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :B0034_Sequence1; + sbol:name "rbs"; + sbol:role SO:0000139; + sbol:type SBO:0000251 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:hasLocation ; + sbol:instanceOf :B0034; + sbol:orientation SO:0001030 . - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; + a sbol:SubComponent; + sbol:displayId "SubComponent1"; sbol:instanceOf :j23101 . - - a sbol:Range ; - sbol:displayId "Range1" ; - sbol:end "738" ; - sbol:hasSequence :i13504_Sequence1 ; - sbol:orientation SO:0001030 ; - sbol:start "19" . +:B0015 a sbol:Component; + sbol:description "B0015 double terminator"; + sbol:displayId "B0015"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :B0015_Sequence1; + sbol:name "terminator"; + sbol:role SO:0000141; + sbol:type SBO:0000251 . - - a sbol:ComponentReference ; - sbol:displayId "ComponentReference1" ; - sbol:inChildOf ; - sbol:refersTo . +:i13504_system a sbol:Component; + sbol:displayId "i13504_system"; + sbol:hasFeature , , ; + sbol:hasInteraction ; + sbol:hasNamespace <../igem>; + sbol:name "i13504 system"; + sbol:role SBO:0000289; + sbol:type SBO:0000241 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :i13504 . +:B0015_Sequence1 a sbol:Sequence; + sbol:description "B0015 sequence"; + sbol:displayId "B0015_Sequence1"; + sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . -:interlab16device2 a sbol:Component ; - sbol:displayId "interlab16device2" ; - sbol:hasConstraint ; - sbol:hasFeature , , ; - sbol:hasNamespace <../igem> ; - sbol:role SO:0000704 ; - sbol:type SBO:0000251 . +:i13504_Sequence1 a sbol:Sequence; + sbol:description "i13504 sequence"; + sbol:displayId "i13504_Sequence1"; + sbol:elements "aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . - - a sbol:Range ; - sbol:displayId "Range1" ; - sbol:end "746" ; - sbol:hasSequence :i13504_Sequence1 ; - sbol:orientation SO:0001030 ; - sbol:start "739" . + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :GFP_protein . - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:hasLocation ; - sbol:instanceOf :B0034 ; - sbol:orientation SO:0001030 . + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000645 . - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; - sbol:role SBO:0000011 . +:B0034_Sequence1 a sbol:Sequence; + sbol:description "B0034 sequence"; + sbol:displayId "B0034_Sequence1"; + sbol:elements "aaagaggagaaa"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . - - a sbol:SequenceFeature ; - sbol:displayId "SequenceFeature2" ; - sbol:hasLocation ; - sbol:orientation SO:0001030 . + + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "826"; + sbol:hasSequence :i13504_Sequence1; + sbol:orientation SO:0001030; + sbol:start "747" . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :j23106 . + + + a sbol:Constraint; + sbol:displayId "Constraint1"; + sbol:object ; + sbol:restriction sbol:meets; + sbol:subject . + + + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "18"; + sbol:hasSequence :i13504_Sequence1; + sbol:orientation SO:0001030; + sbol:start "13" . diff --git a/SBOL3/entity/annotation/annotation.jsonld b/SBOL3/entity/annotation/annotation.jsonld index 1ba995c..ce3ecdf 100644 --- a/SBOL3/entity/annotation/annotation.jsonld +++ b/SBOL3/entity/annotation/annotation.jsonld @@ -1,21 +1,16 @@ { "@graph": [ { - "@id": "https://sbolstandard.org/examples/BBa_J23119/usage1", - "sbol:displayId": "usage1", - "igem:registryStar": "1", - "sbol:name": "BBa_J23119_usage", - "igem:uses": "442", - "igem:twinURLs": { - "@id": "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts" + "@id": "https://sbolstandard.org/examples/SynBioHubRepository", + "sbol:name": "SynBioHub", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "sbol:description": "BBa_J23119 usage statistics", "@type": [ - "sbol:Identified", - "igem:IGEMUsage" + "igem:Repository", + "sbol:TopLevel" ], - "igem:twins": "7", - "igem:inStock": "true" + "sbol:displayId": "SynBioHubRepository" }, { "@id": "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts", @@ -37,58 +32,61 @@ ], "sbol:displayId": "twinParts" }, - { - "@id": "https://sbolstandard.org/examples/iGEMRepository", - "igem:website": { - "@id": "igem:Main_Page" - }, - "sbol:description": "Registry of Standard Biological Parts", - "sbol:name": "iGEM Registry", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "@type": [ - "igem:Repository", - "sbol:TopLevel" - ], - "sbol:displayId": "iGEMRepository" - }, { "@id": "https://sbolstandard.org/examples/BBa_J23119", + "sbol:displayId": "BBa_J23119", + "igem:group": "iGEM2006_Berkeley", "igem:belongsTo": [ { - "@id": "https://sbolstandard.org/examples/iGEMRepository" + "@id": "https://sbolstandard.org/examples/SynBioHubRepository" }, { - "@id": "https://sbolstandard.org/examples/SynBioHubRepository" + "@id": "https://sbolstandard.org/examples/iGEMRepository" } ], - "sbol:role": { - "@id": "SO:0000167" - }, "sbol:description": "Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library.", - "igem:hasInformation": { - "@id": "https://sbolstandard.org/examples/BBa_J23119/information1" - }, - "sbol:name": "BBa_J23119 part", "sbol:type": { "@id": "SBO:0000251" }, - "igem:hasUsage": { - "@id": "https://sbolstandard.org/examples/BBa_J23119/usage1" - }, - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, "@type": "sbol:Component", + "igem:hasInformation": [ + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/information1" + }, + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/information3" + }, + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/information2" + } + ], + "igem:hasUsage": [ + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/usage1" + }, + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/usage2" + }, + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/usage3" + } + ], + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:name": "BBa_J23119 part", "igem:experienceURL": { "@id": "igem:Part:BBa_J23119:Experience" }, - "sbol:displayId": "BBa_J23119", - "igem:group": "iGEM2006_Berkeley" + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + } }, { "@id": "https://sbolstandard.org/examples/BBa_J23119/information1", + "igem:source": { + "@id": "https://sbolstandard.org/examples/BBa_J23119" + }, "igem:regulation": [ "//regulation/second_regulation", "//regulation/constitutive" @@ -103,8 +101,12 @@ "sbol:displayId": "information1" }, { - "@id": "https://sbolstandard.org/examples/SynBioHubRepository", - "sbol:name": "SynBioHub", + "@id": "https://sbolstandard.org/examples/iGEMRepository", + "igem:website": { + "@id": "igem:Main_Page" + }, + "sbol:description": "Registry of Standard Biological Parts", + "sbol:name": "iGEM Registry", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, @@ -112,7 +114,65 @@ "igem:Repository", "sbol:TopLevel" ], - "sbol:displayId": "SynBioHubRepository" + "sbol:displayId": "iGEMRepository" + }, + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/usage1", + "@type": [ + "sbol:Identified", + "igem:iGEMUsage" + ], + "sbol:description": "BBa_J23119 usage statistics", + "sbol:name": "BBa_J23119_usage", + "sbol:displayId": "usage1", + "igem:registryStar": "1", + "igem:twins": "7", + "igem:uses2": { + "@value": "442", + "@type": "http://www.w3.org/2001/XMLSchema#int" + }, + "igem:uses": "442", + "igem:twinURLs": { + "@id": "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts" + }, + "igem:inStock": "true" + }, + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/usage2", + "igem:twins": "7", + "sbol:name": "BBa_J23119_usage_2", + "@type": [ + "igem:A_iGEMUsage", + "sbol:Identified" + ], + "sbol:displayId": "usage2" + }, + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/information3", + "sbol:name": "BBa_J23119_experience3", + "@type": [ + "igem:Z_Information", + "sbol:Identified" + ], + "sbol:displayId": "information3" + }, + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/usage3", + "sbol:name": "BBa_J23119_usage_3", + "@type": [ + "igem:Z_iGEMUsage", + "sbol:Identified" + ], + "sbol:displayId": "usage3" + }, + { + "@id": "https://sbolstandard.org/examples/BBa_J23119/information2", + "sbol:name": "BBa_J23119_experience2", + "@type": [ + "igem:A_Information", + "sbol:Identified" + ], + "sbol:displayId": "information2" } ], "@context": { diff --git a/SBOL3/entity/annotation/annotation.jsonld_expanded b/SBOL3/entity/annotation/annotation.jsonld_expanded index 8dec7ec..9b95295 100644 --- a/SBOL3/entity/annotation/annotation.jsonld_expanded +++ b/SBOL3/entity/annotation/annotation.jsonld_expanded @@ -1,132 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/BBa_J23119", - "http://parts.igem.org/belongsTo" : [ { - "@id" : "https://sbolstandard.org/examples/iGEMRepository" - }, { - "@id" : "https://sbolstandard.org/examples/SynBioHubRepository" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000167" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library." - } ], - "http://parts.igem.org/hasInformation" : [ { - "@id" : "https://sbolstandard.org/examples/BBa_J23119/information1" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "BBa_J23119 part" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://parts.igem.org/hasUsage" : [ { - "@id" : "https://sbolstandard.org/examples/BBa_J23119/usage1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://parts.igem.org/experienceURL" : [ { - "@id" : "http://parts.igem.org/Part:BBa_J23119:Experience" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "BBa_J23119" - } ], - "http://parts.igem.org/group" : [ { - "@value" : "iGEM2006_Berkeley" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/BBa_J23119/information1", - "http://parts.igem.org/regulation" : [ { - "@value" : "//regulation/second_regulation" - }, { - "@value" : "//regulation/constitutive" - } ], - "http://parts.igem.org/sigmaFactor" : [ { - "@value" : "//rnap/prokaryote/ecoli/sigma70" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "The experience page captures users' experience using the BBa_J23119 part" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "BBa_J23119_experience" - } ], - "@type" : [ "http://parts.igem.org/Information", "http://sbols.org/v3#Identified" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "information1" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/BBa_J23119/usage1", - "http://sbols.org/v3#displayId" : [ { - "@value" : "usage1" - } ], - "http://parts.igem.org/registryStar" : [ { - "@value" : "1" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "BBa_J23119_usage" - } ], - "http://parts.igem.org/uses" : [ { - "@value" : "442" - } ], - "http://parts.igem.org/twinURLs" : [ { - "@id" : "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "BBa_J23119 usage statistics" - } ], - "@type" : [ "http://sbols.org/v3#Identified", "http://parts.igem.org/IGEMUsage" ], - "http://parts.igem.org/twins" : [ { - "@value" : "7" - } ], - "http://parts.igem.org/inStock" : [ { - "@value" : "true" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts", - "http://parts.igem.org/twinURL" : [ { - "@id" : "http://parts.igem.org/wiki/index.php?title=Part:BBa_M36800" - }, { - "@id" : "http://parts.igem.org/wiki/index.php?title=Part:BBa_M1638" - }, { - "@id" : "http://parts.igem.org/wiki/index.php?title=Part:BBa_J72073" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "twin parts" - } ], - "@type" : [ "http://parts.igem.org/TwinPartUsage", "http://sbols.org/v3#Identified" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "twinParts" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/SynBioHubRepository", - "http://sbols.org/v3#name" : [ { - "@value" : "SynBioHub" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://parts.igem.org/Repository", "http://sbols.org/v3#TopLevel" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SynBioHubRepository" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/iGEMRepository", - "http://parts.igem.org/website" : [ { - "@id" : "http://parts.igem.org/Main_Page" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Registry of Standard Biological Parts" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "iGEM Registry" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://parts.igem.org/Repository", "http://sbols.org/v3#TopLevel" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "iGEMRepository" - } ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/SynBioHubRepository","http://sbols.org/v3#name":[{"@value":"SynBioHub"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://parts.igem.org/Repository","http://sbols.org/v3#TopLevel"],"http://sbols.org/v3#displayId":[{"@value":"SynBioHubRepository"}]},{"@id":"https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts","http://parts.igem.org/twinURL":[{"@id":"http://parts.igem.org/wiki/index.php?title=Part:BBa_M36800"},{"@id":"http://parts.igem.org/wiki/index.php?title=Part:BBa_M1638"},{"@id":"http://parts.igem.org/wiki/index.php?title=Part:BBa_J72073"}],"http://sbols.org/v3#name":[{"@value":"twin parts"}],"@type":["http://parts.igem.org/TwinPartUsage","http://sbols.org/v3#Identified"],"http://sbols.org/v3#displayId":[{"@value":"twinParts"}]},{"@id":"https://sbolstandard.org/examples/BBa_J23119","http://sbols.org/v3#displayId":[{"@value":"BBa_J23119"}],"http://parts.igem.org/group":[{"@value":"iGEM2006_Berkeley"}],"http://parts.igem.org/belongsTo":[{"@id":"https://sbolstandard.org/examples/SynBioHubRepository"},{"@id":"https://sbolstandard.org/examples/iGEMRepository"}],"http://sbols.org/v3#description":[{"@value":"Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library."}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"@type":["http://sbols.org/v3#Component"],"http://parts.igem.org/hasInformation":[{"@id":"https://sbolstandard.org/examples/BBa_J23119/information1"},{"@id":"https://sbolstandard.org/examples/BBa_J23119/information3"},{"@id":"https://sbolstandard.org/examples/BBa_J23119/information2"}],"http://parts.igem.org/hasUsage":[{"@id":"https://sbolstandard.org/examples/BBa_J23119/usage1"},{"@id":"https://sbolstandard.org/examples/BBa_J23119/usage2"},{"@id":"https://sbolstandard.org/examples/BBa_J23119/usage3"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000167"}],"http://sbols.org/v3#name":[{"@value":"BBa_J23119 part"}],"http://parts.igem.org/experienceURL":[{"@id":"http://parts.igem.org/Part:BBa_J23119:Experience"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}]},{"@id":"https://sbolstandard.org/examples/BBa_J23119/information1","http://parts.igem.org/source":[{"@id":"https://sbolstandard.org/examples/BBa_J23119"}],"http://parts.igem.org/regulation":[{"@value":"//regulation/second_regulation"},{"@value":"//regulation/constitutive"}],"http://parts.igem.org/sigmaFactor":[{"@value":"//rnap/prokaryote/ecoli/sigma70"}],"http://sbols.org/v3#description":[{"@value":"The experience page captures users' experience using the BBa_J23119 part"}],"http://sbols.org/v3#name":[{"@value":"BBa_J23119_experience"}],"@type":["http://parts.igem.org/Information","http://sbols.org/v3#Identified"],"http://sbols.org/v3#displayId":[{"@value":"information1"}]},{"@id":"https://sbolstandard.org/examples/iGEMRepository","http://parts.igem.org/website":[{"@id":"http://parts.igem.org/Main_Page"}],"http://sbols.org/v3#description":[{"@value":"Registry of Standard Biological Parts"}],"http://sbols.org/v3#name":[{"@value":"iGEM Registry"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://parts.igem.org/Repository","http://sbols.org/v3#TopLevel"],"http://sbols.org/v3#displayId":[{"@value":"iGEMRepository"}]},{"@id":"https://sbolstandard.org/examples/BBa_J23119/usage1","@type":["http://sbols.org/v3#Identified","http://parts.igem.org/iGEMUsage"],"http://sbols.org/v3#description":[{"@value":"BBa_J23119 usage statistics"}],"http://sbols.org/v3#name":[{"@value":"BBa_J23119_usage"}],"http://sbols.org/v3#displayId":[{"@value":"usage1"}],"http://parts.igem.org/registryStar":[{"@value":"1"}],"http://parts.igem.org/twins":[{"@value":"7"}],"http://parts.igem.org/uses2":[{"@value":"442","@type":"http://www.w3.org/2001/XMLSchema#int"}],"http://parts.igem.org/uses":[{"@value":"442"}],"http://parts.igem.org/twinURLs":[{"@id":"https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts"}],"http://parts.igem.org/inStock":[{"@value":"true"}]},{"@id":"https://sbolstandard.org/examples/BBa_J23119/usage2","http://parts.igem.org/twins":[{"@value":"7"}],"http://sbols.org/v3#name":[{"@value":"BBa_J23119_usage_2"}],"@type":["http://parts.igem.org/A_iGEMUsage","http://sbols.org/v3#Identified"],"http://sbols.org/v3#displayId":[{"@value":"usage2"}]},{"@id":"https://sbolstandard.org/examples/BBa_J23119/information3","http://sbols.org/v3#name":[{"@value":"BBa_J23119_experience3"}],"@type":["http://parts.igem.org/Z_Information","http://sbols.org/v3#Identified"],"http://sbols.org/v3#displayId":[{"@value":"information3"}]},{"@id":"https://sbolstandard.org/examples/BBa_J23119/usage3","http://sbols.org/v3#name":[{"@value":"BBa_J23119_usage_3"}],"@type":["http://parts.igem.org/Z_iGEMUsage","http://sbols.org/v3#Identified"],"http://sbols.org/v3#displayId":[{"@value":"usage3"}]},{"@id":"https://sbolstandard.org/examples/BBa_J23119/information2","http://sbols.org/v3#name":[{"@value":"BBa_J23119_experience2"}],"@type":["http://parts.igem.org/A_Information","http://sbols.org/v3#Identified"],"http://sbols.org/v3#displayId":[{"@value":"information2"}]}]} \ No newline at end of file diff --git a/SBOL3/entity/annotation/annotation.nt b/SBOL3/entity/annotation/annotation.nt index b70cd7c..1958d61 100644 --- a/SBOL3/entity/annotation/annotation.nt +++ b/SBOL3/entity/annotation/annotation.nt @@ -1,33 +1,3 @@ - "usage1" . - "1" . - "BBa_J23119_usage" . - "442" . - . - "BBa_J23119 usage statistics" . - . - . - "7" . - "true" . - . - "Registry of Standard Biological Parts" . - "iGEM Registry" . - . - . - "iGEMRepository" . - . - . - . - "Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library." . - . - . - "BBa_J23119 part" . - . - . - . - . - . - "BBa_J23119" . - "iGEM2006_Berkeley" . "SynBioHub" . . . @@ -40,6 +10,35 @@ . "twinParts" . . + "BBa_J23119" . + "iGEM2006_Berkeley" . + . + "Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library." . + . + . + . + . + . + . + . + "BBa_J23119 part" . + . + . + . + . + . + . + "BBa_J23119 usage statistics" . + "BBa_J23119_usage" . + . + "usage1" . + "1" . + "7" . + "442"^^ . + "442" . + . + "true" . + . "//regulation/second_regulation" . "//regulation/constitutive" . "//rnap/prokaryote/ecoli/sigma70" . @@ -48,3 +47,27 @@ . "information1" . . + "BBa_J23119_usage_3" . + . + "usage3" . + . + "BBa_J23119_experience3" . + . + "information3" . + . + . + "Registry of Standard Biological Parts" . + "iGEM Registry" . + . + . + "iGEMRepository" . + . + "7" . + "BBa_J23119_usage_2" . + . + "usage2" . + . + "BBa_J23119_experience2" . + . + "information2" . + . diff --git a/SBOL3/entity/annotation/annotation.rdf b/SBOL3/entity/annotation/annotation.rdf index 870e65a..b6b5d1a 100644 --- a/SBOL3/entity/annotation/annotation.rdf +++ b/SBOL3/entity/annotation/annotation.rdf @@ -12,20 +12,21 @@ xmlns:om="http://www.ontology-of-units-of-measure.org/resource/om-2/" xml:base="https://sbolstandard.org/examples/"> + BBa_J23119 + iGEM2006_Berkeley - - - Registry of Standard Biological Parts - iGEM Registry + + SynBioHub - iGEMRepository + SynBioHubRepository - Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library. + + //regulation/second_regulation //regulation/constitutive //rnap/prokaryote/ecoli/sigma70 @@ -36,20 +37,25 @@ - - SynBioHub + + + Registry of Standard Biological Parts + iGEM Registry - SynBioHubRepository + iGEMRepository - BBa_J23119 part - + BBa_J23119 usage statistics + BBa_J23119_usage + usage1 1 - BBa_J23119_usage + 7 + 442 442 @@ -61,15 +67,41 @@ - BBa_J23119 usage statistics - - 7 true - + + + + 7 + BBa_J23119_usage_2 + usage2 + + + + BBa_J23119 part + + + BBa_J23119_experience3 + information3 + + + + + + BBa_J23119_usage_3 + usage3 + + + - BBa_J23119 - iGEM2006_Berkeley + + + + BBa_J23119_experience2 + information2 + + + diff --git a/SBOL3/entity/annotation/annotation.rj b/SBOL3/entity/annotation/annotation.rj index 229a423..9783a78 100644 --- a/SBOL3/entity/annotation/annotation.rj +++ b/SBOL3/entity/annotation/annotation.rj @@ -1,32 +1,84 @@ { - "https://sbolstandard.org/examples/BBa_J23119/usage1" : { + "https://sbolstandard.org/examples/BBa_J23119/usage3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "usage1" + "value" : "usage3" } ] , - "http://parts.igem.org/twins" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "7" + "value" : "BBa_J23119_usage_3" } ] , - "http://parts.igem.org/inStock" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://parts.igem.org/Z_iGEMUsage" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#Identified" + } + ] + } + , + "https://sbolstandard.org/examples/BBa_J23119/information2" : { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "true" + "value" : "information2" } ] , - "http://parts.igem.org/twinURLs" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "BBa_J23119_experience2" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://parts.igem.org/A_Information" + } + , { "type" : "uri" , "value" : "http://sbols.org/v3#Identified" + } + ] + } + , + "https://sbolstandard.org/examples/BBa_J23119/information3" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "information3" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "BBa_J23119_experience3" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://parts.igem.org/Z_Information" } , { "type" : "uri" , - "value" : "http://parts.igem.org/IGEMUsage" + "value" : "http://sbols.org/v3#Identified" + } + ] + } + , + "https://sbolstandard.org/examples/BBa_J23119/usage1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "usage1" + } + ] , + "http://parts.igem.org/twins" : [ { + "type" : "literal" , + "value" : "7" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "BBa_J23119 usage statistics" } ] , "http://parts.igem.org/registryStar" : [ { @@ -39,9 +91,29 @@ "value" : "BBa_J23119_usage" } ] , - "http://sbols.org/v3#description" : [ { + "http://parts.igem.org/inStock" : [ { "type" : "literal" , - "value" : "BBa_J23119 usage statistics" + "value" : "true" + } + ] , + "http://parts.igem.org/twinURLs" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://parts.igem.org/iGEMUsage" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#Identified" + } + ] , + "http://parts.igem.org/uses2" : [ { + "type" : "literal" , + "value" : "442" , + "datatype" : "http://www.w3.org/2001/XMLSchema#int" } ] , "http://parts.igem.org/uses" : [ { @@ -51,19 +123,10 @@ ] } , - "https://sbolstandard.org/examples/iGEMRepository" : { + "https://sbolstandard.org/examples/SynBioHubRepository" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "iGEMRepository" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://parts.igem.org/Repository" - } - , { - "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "value" : "SynBioHubRepository" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -73,17 +136,16 @@ ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "iGEM Registry" + "value" : "SynBioHub" } ] , - "http://parts.igem.org/website" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://parts.igem.org/Main_Page" + "value" : "http://sbols.org/v3#TopLevel" } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Registry of Standard Biological Parts" + , { + "type" : "uri" , + "value" : "http://parts.igem.org/Repository" } ] } @@ -94,13 +156,19 @@ "value" : "information1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://parts.igem.org/source" : [ { "type" : "uri" , - "value" : "http://parts.igem.org/Information" + "value" : "https://sbolstandard.org/examples/BBa_J23119" } - , { - "type" : "uri" , - "value" : "http://sbols.org/v3#Identified" + ] , + "http://parts.igem.org/sigmaFactor" : [ { + "type" : "literal" , + "value" : "//rnap/prokaryote/ecoli/sigma70" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "The experience page captures users' experience using the BBa_J23119 part" } ] , "http://sbols.org/v3#name" : [ { @@ -110,83 +178,82 @@ ] , "http://parts.igem.org/regulation" : [ { "type" : "literal" , - "value" : "//regulation/constitutive" + "value" : "//regulation/second_regulation" } , { "type" : "literal" , - "value" : "//regulation/second_regulation" + "value" : "//regulation/constitutive" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "The experience page captures users' experience using the BBa_J23119 part" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://parts.igem.org/Information" } - ] , - "http://parts.igem.org/sigmaFactor" : [ { - "type" : "literal" , - "value" : "//rnap/prokaryote/ecoli/sigma70" + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#Identified" } ] } , - "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts" : { + "https://sbolstandard.org/examples/BBa_J23119/usage2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "twinParts" + "value" : "usage2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://parts.igem.org/TwinPartUsage" - } - , { - "type" : "uri" , - "value" : "http://sbols.org/v3#Identified" + "http://parts.igem.org/twins" : [ { + "type" : "literal" , + "value" : "7" } ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "twin parts" + "value" : "BBa_J23119_usage_2" } ] , - "http://parts.igem.org/twinURL" : [ { - "type" : "uri" , - "value" : "http://parts.igem.org/wiki/index.php?title=Part:BBa_M1638" - } - , { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://parts.igem.org/wiki/index.php?title=Part:BBa_J72073" + "value" : "http://parts.igem.org/A_iGEMUsage" } , { "type" : "uri" , - "value" : "http://parts.igem.org/wiki/index.php?title=Part:BBa_M36800" + "value" : "http://sbols.org/v3#Identified" } ] } , - "https://sbolstandard.org/examples/SynBioHubRepository" : { + "https://sbolstandard.org/examples/BBa_J23119/usage1/twinParts" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SynBioHubRepository" + "value" : "twinParts" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://parts.igem.org/twinURL" : [ { "type" : "uri" , - "value" : "http://parts.igem.org/Repository" + "value" : "http://parts.igem.org/wiki/index.php?title=Part:BBa_M1638" } , { "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "value" : "http://parts.igem.org/wiki/index.php?title=Part:BBa_M36800" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "http://parts.igem.org/wiki/index.php?title=Part:BBa_J72073" } ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "SynBioHub" + "value" : "twin parts" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://parts.igem.org/TwinPartUsage" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#Identified" } ] } @@ -197,63 +264,116 @@ "value" : "BBa_J23119" } ] , + "http://parts.igem.org/group" : [ { + "type" : "literal" , + "value" : "iGEM2006_Berkeley" + } + ] , + "http://parts.igem.org/hasInformation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/BBa_J23119/information2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/BBa_J23119/information3" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/BBa_J23119/information1" + } + ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , "value" : "https://identifiers.org/SO:0000167" } ] , - "http://parts.igem.org/group" : [ { + "http://parts.igem.org/belongsTo" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/SynBioHubRepository" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/iGEMRepository" + } + ] , + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "iGEM2006_Berkeley" + "value" : "Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library." } ] , - "http://parts.igem.org/hasUsage" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/BBa_J23119/usage1" + "value" : "https://sbolstandard.org/examples" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://parts.igem.org/experienceURL" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "http://parts.igem.org/Part:BBa_J23119:Experience" } ] , - "http://parts.igem.org/hasInformation" : [ { + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "BBa_J23119 part" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/BBa_J23119/information1" + "value" : "http://sbols.org/v3#Component" } ] , - "http://parts.igem.org/belongsTo" : [ { + "http://parts.igem.org/hasUsage" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/iGEMRepository" + "value" : "https://sbolstandard.org/examples/BBa_J23119/usage3" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SynBioHubRepository" + "value" : "https://sbolstandard.org/examples/BBa_J23119/usage1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/BBa_J23119/usage2" + } + ] + } + , + "https://sbolstandard.org/examples/iGEMRepository" : { + "http://parts.igem.org/website" : [ { + "type" : "uri" , + "value" : "http://parts.igem.org/Main_Page" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "BBa_J23119 part" + "value" : "iGEMRepository" } ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library." + "value" : "Registry of Standard Biological Parts" } ] , - "http://parts.igem.org/experienceURL" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://parts.igem.org/Part:BBa_J23119:Experience" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "iGEM Registry" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#TopLevel" + } + , { + "type" : "uri" , + "value" : "http://parts.igem.org/Repository" } ] } diff --git a/SBOL3/entity/annotation/annotation.ttl b/SBOL3/entity/annotation/annotation.ttl index 116033a..5e02440 100644 --- a/SBOL3/entity/annotation/annotation.ttl +++ b/SBOL3/entity/annotation/annotation.ttl @@ -1,60 +1,81 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix igem: . -@prefix om: . -@prefix prov: . -@prefix sbol: . - - a sbol:Identified , igem:IGEMUsage ; - igem:inStock "true" ; - igem:registryStar "1" ; - igem:twinURLs ; - igem:twins "7" ; - igem:uses "442" ; - sbol:description "BBa_J23119 usage statistics" ; - sbol:displayId "usage1" ; - sbol:name "BBa_J23119_usage" . - -:iGEMRepository a igem:Repository , sbol:TopLevel ; - igem:website igem:Main_Page ; - sbol:description "Registry of Standard Biological Parts" ; - sbol:displayId "iGEMRepository" ; - sbol:hasNamespace ; - sbol:name "iGEM Registry" . - -:BBa_J23119 a sbol:Component ; - igem:belongsTo :iGEMRepository , :SynBioHubRepository ; - igem:experienceURL igem:Part:BBa_J23119:Experience ; - igem:group "iGEM2006_Berkeley" ; - igem:hasInformation ; - igem:hasUsage ; - sbol:description "Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library." ; - sbol:displayId "BBa_J23119" ; - sbol:hasNamespace ; - sbol:name "BBa_J23119 part" ; - sbol:role SO:0000167 ; - sbol:type SBO:0000251 . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX igem: +PREFIX om: +PREFIX prov: +PREFIX sbol: -:SynBioHubRepository a igem:Repository , sbol:TopLevel ; - sbol:displayId "SynBioHubRepository" ; - sbol:hasNamespace ; +:SynBioHubRepository a igem:Repository , sbol:TopLevel; + sbol:displayId "SynBioHubRepository"; + sbol:hasNamespace ; sbol:name "SynBioHub" . - a igem:TwinPartUsage , sbol:Identified ; - igem:twinURL , , ; - sbol:displayId "twinParts" ; + a igem:TwinPartUsage , sbol:Identified; + igem:twinURL , , ; + sbol:displayId "twinParts"; sbol:name "twin parts" . +:BBa_J23119 a sbol:Component; + igem:belongsTo :SynBioHubRepository , :iGEMRepository; + igem:experienceURL igem:Part:BBa_J23119:Experience; + igem:group "iGEM2006_Berkeley"; + igem:hasInformation , , ; + igem:hasUsage , , ; + sbol:description "Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library."; + sbol:displayId "BBa_J23119"; + sbol:hasNamespace ; + sbol:name "BBa_J23119 part"; + sbol:role SO:0000167; + sbol:type SBO:0000251 . + + a sbol:Identified , igem:iGEMUsage; + igem:inStock "true"; + igem:registryStar "1"; + igem:twinURLs ; + igem:twins "7"; + igem:uses "442"; + igem:uses2 "442"^^; + sbol:description "BBa_J23119 usage statistics"; + sbol:displayId "usage1"; + sbol:name "BBa_J23119_usage" . + - a igem:Information , sbol:Identified ; - igem:regulation "//regulation/second_regulation" , "//regulation/constitutive" ; - igem:sigmaFactor "//rnap/prokaryote/ecoli/sigma70" ; - sbol:description "The experience page captures users' experience using the BBa_J23119 part" ; - sbol:displayId "information1" ; + a igem:Information , sbol:Identified; + igem:regulation "//regulation/second_regulation" , "//regulation/constitutive"; + igem:sigmaFactor "//rnap/prokaryote/ecoli/sigma70"; + igem:source :BBa_J23119; + sbol:description "The experience page captures users' experience using the BBa_J23119 part"; + sbol:displayId "information1"; sbol:name "BBa_J23119_experience" . + + a igem:Z_iGEMUsage , sbol:Identified; + sbol:displayId "usage3"; + sbol:name "BBa_J23119_usage_3" . + + + a igem:Z_Information , sbol:Identified; + sbol:displayId "information3"; + sbol:name "BBa_J23119_experience3" . + +:iGEMRepository a igem:Repository , sbol:TopLevel; + igem:website igem:Main_Page; + sbol:description "Registry of Standard Biological Parts"; + sbol:displayId "iGEMRepository"; + sbol:hasNamespace ; + sbol:name "iGEM Registry" . + + a igem:A_iGEMUsage , sbol:Identified; + igem:twins "7"; + sbol:displayId "usage2"; + sbol:name "BBa_J23119_usage_2" . + + + a igem:A_Information , sbol:Identified; + sbol:displayId "information2"; + sbol:name "BBa_J23119_experience2" . diff --git a/SBOL3/entity/annotation/annotation_ordered.nt b/SBOL3/entity/annotation/annotation_ordered.nt index 389b2e6..6c66e63 100644 --- a/SBOL3/entity/annotation/annotation_ordered.nt +++ b/SBOL3/entity/annotation/annotation_ordered.nt @@ -1,11 +1,20 @@ "//regulation/constitutive" . "//regulation/second_regulation" . "//rnap/prokaryote/ecoli/sigma70" . + . "The experience page captures users' experience using the BBa_J23119 part" . "information1" . "BBa_J23119_experience" . . . + "information2" . + "BBa_J23119_experience2" . + . + . + "information3" . + "BBa_J23119_experience3" . + . + . . . . @@ -17,18 +26,32 @@ "1" . . "7" . + "442"^^ . "442" . "BBa_J23119 usage statistics" . "usage1" . "BBa_J23119_usage" . - . + . . + "7" . + "usage2" . + "BBa_J23119_usage_2" . + . + . + "usage3" . + "BBa_J23119_usage_3" . + . + . . . . "iGEM2006_Berkeley" . . + . + . . + . + . "Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library." . "BBa_J23119" . . diff --git a/SBOL3/entity/attachment/attachment.jsonld b/SBOL3/entity/attachment/attachment.jsonld index f76ffb4..356c929 100644 --- a/SBOL3/entity/attachment/attachment.jsonld +++ b/SBOL3/entity/attachment/attachment.jsonld @@ -17,6 +17,23 @@ "sbol:displayId": "attachment1", "@type": "sbol:Attachment" }, + { + "@id": "https://sbolstandard.org/examples/attachment2", + "sbol:hash": "aaa", + "sbol:hashAlgorithm": "sha-256", + "sbol:size": "1000", + "sbol:format": { + "@id": "EDAM:format_2585" + }, + "sbol:source": { + "@id": "https://sbolstandard.org/attachment2" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "attachment2", + "@type": "sbol:Attachment" + }, { "@id": "https://sbolstandard.org/examples/impl1", "sbol:hasAttachment": { @@ -46,23 +63,6 @@ }, "sbol:displayId": "TetR_protein", "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/attachment2", - "sbol:hash": "aaa", - "sbol:hashAlgorithm": "sha-256", - "sbol:size": "1000", - "sbol:format": { - "@id": "EDAM:format_2585" - }, - "sbol:source": { - "@id": "https://sbolstandard.org/attachment2" - }, - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "attachment2", - "@type": "sbol:Attachment" } ], "@context": { diff --git a/SBOL3/entity/attachment/attachment.jsonld_expanded b/SBOL3/entity/attachment/attachment.jsonld_expanded index 492ac19..f513516 100644 --- a/SBOL3/entity/attachment/attachment.jsonld_expanded +++ b/SBOL3/entity/attachment/attachment.jsonld_expanded @@ -1,85 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/TetR_protein", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/GO:0003700" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "TetR protein" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "TetR" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "TetR_protein" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/attachment1", - "http://sbols.org/v3#hash" : [ { - "@value" : "aaa" - } ], - "http://sbols.org/v3#hashAlgorithm" : [ { - "@value" : "sha-256" - } ], - "http://sbols.org/v3#size" : [ { - "@value" : "1000" - } ], - "http://sbols.org/v3#format" : [ { - "@id" : "https://identifiers.org/edam:format_2585" - } ], - "http://sbols.org/v3#source" : [ { - "@id" : "https://sbolstandard.org/attachment1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "attachment1" - } ], - "@type" : [ "http://sbols.org/v3#Attachment" ] -}, { - "@id" : "https://sbolstandard.org/examples/attachment2", - "http://sbols.org/v3#hash" : [ { - "@value" : "aaa" - } ], - "http://sbols.org/v3#hashAlgorithm" : [ { - "@value" : "sha-256" - } ], - "http://sbols.org/v3#size" : [ { - "@value" : "1000" - } ], - "http://sbols.org/v3#format" : [ { - "@id" : "https://identifiers.org/edam:format_2585" - } ], - "http://sbols.org/v3#source" : [ { - "@id" : "https://sbolstandard.org/attachment2" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "attachment2" - } ], - "@type" : [ "http://sbols.org/v3#Attachment" ] -}, { - "@id" : "https://sbolstandard.org/examples/impl1", - "http://sbols.org/v3#hasAttachment" : [ { - "@id" : "https://sbolstandard.org/examples/attachment1" - } ], - "http://sbols.org/v3#built" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_protein" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "impl1" - } ], - "@type" : [ "http://sbols.org/v3#Implementation" ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/attachment1","http://sbols.org/v3#hash":[{"@value":"aaa"}],"http://sbols.org/v3#hashAlgorithm":[{"@value":"sha-256"}],"http://sbols.org/v3#size":[{"@value":"1000"}],"http://sbols.org/v3#format":[{"@id":"https://identifiers.org/edam:format_2585"}],"http://sbols.org/v3#source":[{"@id":"https://sbolstandard.org/attachment1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"attachment1"}],"@type":["http://sbols.org/v3#Attachment"]},{"@id":"https://sbolstandard.org/examples/attachment2","http://sbols.org/v3#hash":[{"@value":"aaa"}],"http://sbols.org/v3#hashAlgorithm":[{"@value":"sha-256"}],"http://sbols.org/v3#size":[{"@value":"1000"}],"http://sbols.org/v3#format":[{"@id":"https://identifiers.org/edam:format_2585"}],"http://sbols.org/v3#source":[{"@id":"https://sbolstandard.org/attachment2"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"attachment2"}],"@type":["http://sbols.org/v3#Attachment"]},{"@id":"https://sbolstandard.org/examples/impl1","http://sbols.org/v3#hasAttachment":[{"@id":"https://sbolstandard.org/examples/attachment1"}],"http://sbols.org/v3#built":[{"@id":"https://sbolstandard.org/examples/TetR_protein"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"impl1"}],"@type":["http://sbols.org/v3#Implementation"]},{"@id":"https://sbolstandard.org/examples/TetR_protein","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#description":[{"@value":"TetR protein"}],"http://sbols.org/v3#name":[{"@value":"TetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#displayId":[{"@value":"TetR_protein"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/attachment/attachment.nt b/SBOL3/entity/attachment/attachment.nt index c7e373b..6f17faf 100644 --- a/SBOL3/entity/attachment/attachment.nt +++ b/SBOL3/entity/attachment/attachment.nt @@ -6,6 +6,14 @@ . "attachment1" . . + "aaa" . + "sha-256" . + "1000" . + . + . + . + "attachment2" . + . . . . @@ -18,11 +26,3 @@ . "TetR_protein" . . - "aaa" . - "sha-256" . - "1000" . - . - . - . - "attachment2" . - . diff --git a/SBOL3/entity/attachment/attachment.rdf b/SBOL3/entity/attachment/attachment.rdf index 991e7a9..4b445fe 100644 --- a/SBOL3/entity/attachment/attachment.rdf +++ b/SBOL3/entity/attachment/attachment.rdf @@ -28,22 +28,22 @@ TetR_protein - + aaa sha-256 1000 - + - attachment2 + attachment1 - + aaa sha-256 1000 - + - attachment1 + attachment2 diff --git a/SBOL3/entity/attachment/attachment.rj b/SBOL3/entity/attachment/attachment.rj index dadc50a..4177b96 100644 --- a/SBOL3/entity/attachment/attachment.rj +++ b/SBOL3/entity/attachment/attachment.rj @@ -1,13 +1,18 @@ { - "https://sbolstandard.org/examples/impl1" : { + "https://sbolstandard.org/examples/TetR_protein" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "impl1" + "value" : "TetR_protein" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Implementation" + "value" : "https://identifiers.org/GO:0003700" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "TetR protein" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -15,42 +20,32 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#built" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_protein" + "value" : "https://identifiers.org/SBO:0000252" } ] , - "http://sbols.org/v3#hasAttachment" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/attachment1" - } - ] - } - , - "https://sbolstandard.org/examples/attachment2" : { - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "attachment2" + "value" : "TetR" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Attachment" - } - ] , - "http://sbols.org/v3#format" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/edam:format_2585" + "value" : "http://sbols.org/v3#Component" } - ] , + ] + } + , + "https://sbolstandard.org/examples/attachment1" : { "http://sbols.org/v3#hash" : [ { "type" : "literal" , "value" : "aaa" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#format" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://identifiers.org/edam:format_2585" } ] , "http://sbols.org/v3#size" : [ { @@ -58,42 +53,42 @@ "value" : "1000" } ] , - "http://sbols.org/v3#source" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/attachment2" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "attachment1" } ] , "http://sbols.org/v3#hashAlgorithm" : [ { "type" : "literal" , "value" : "sha-256" - } - ] - } - , - "https://sbolstandard.org/examples/attachment1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "attachment1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Attachment" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#format" : [ { + "http://sbols.org/v3#source" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_2585" + "value" : "https://sbolstandard.org/attachment1" } ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Attachment" + } + ] + } + , + "https://sbolstandard.org/examples/attachment2" : { "http://sbols.org/v3#hash" : [ { "type" : "literal" , "value" : "aaa" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#format" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://identifiers.org/edam:format_2585" } ] , "http://sbols.org/v3#size" : [ { @@ -101,52 +96,57 @@ "value" : "1000" } ] , - "http://sbols.org/v3#source" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/attachment1" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "attachment2" } ] , "http://sbols.org/v3#hashAlgorithm" : [ { "type" : "literal" , "value" : "sha-256" } - ] - } - , - "https://sbolstandard.org/examples/TetR_protein" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "TetR_protein" + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#source" : [ { "type" : "uri" , - "value" : "https://identifiers.org/GO:0003700" + "value" : "https://sbolstandard.org/attachment2" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#Attachment" + } + ] + } + , + "https://sbolstandard.org/examples/impl1" : { + "http://sbols.org/v3#built" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_protein" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#hasAttachment" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://sbolstandard.org/examples/attachment1" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "TetR" + "value" : "impl1" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "TetR protein" + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Implementation" } ] } diff --git a/SBOL3/entity/attachment/attachment.ttl b/SBOL3/entity/attachment/attachment.ttl index 0482a46..0c5e193 100644 --- a/SBOL3/entity/attachment/attachment.ttl +++ b/SBOL3/entity/attachment/attachment.ttl @@ -1,42 +1,42 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: -:attachment1 a sbol:Attachment ; - sbol:displayId "attachment1" ; - sbol:format EDAM:format_2585 ; - sbol:hasNamespace ; - sbol:hash "aaa" ; - sbol:hashAlgorithm "sha-256" ; - sbol:size "1000" ; +:attachment1 a sbol:Attachment; + sbol:displayId "attachment1"; + sbol:format EDAM:format_2585; + sbol:hasNamespace ; + sbol:hash "aaa"; + sbol:hashAlgorithm "sha-256"; + sbol:size "1000"; sbol:source . -:impl1 a sbol:Implementation ; - sbol:built :TetR_protein ; - sbol:displayId "impl1" ; - sbol:hasAttachment :attachment1 ; +:attachment2 a sbol:Attachment; + sbol:displayId "attachment2"; + sbol:format EDAM:format_2585; + sbol:hasNamespace ; + sbol:hash "aaa"; + sbol:hashAlgorithm "sha-256"; + sbol:size "1000"; + sbol:source . + +:impl1 a sbol:Implementation; + sbol:built :TetR_protein; + sbol:displayId "impl1"; + sbol:hasAttachment :attachment1; sbol:hasNamespace . -:TetR_protein a sbol:Component ; - sbol:description "TetR protein" ; - sbol:displayId "TetR_protein" ; - sbol:hasNamespace ; - sbol:name "TetR" ; - sbol:role GO:0003700 ; +:TetR_protein a sbol:Component; + sbol:description "TetR protein"; + sbol:displayId "TetR_protein"; + sbol:hasNamespace ; + sbol:name "TetR"; + sbol:role GO:0003700; sbol:type SBO:0000252 . - -:attachment2 a sbol:Attachment ; - sbol:displayId "attachment2" ; - sbol:format EDAM:format_2585 ; - sbol:hasNamespace ; - sbol:hash "aaa" ; - sbol:hashAlgorithm "sha-256" ; - sbol:size "1000" ; - sbol:source . diff --git a/SBOL3/entity/collection/collection.jsonld_expanded b/SBOL3/entity/collection/collection.jsonld_expanded index 35fdc7d..cb5cd61 100644 --- a/SBOL3/entity/collection/collection.jsonld_expanded +++ b/SBOL3/entity/collection/collection.jsonld_expanded @@ -1,57 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/LacI_protein", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/GO:0003700" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "LacI protein" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "LacI" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "LacI_protein" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_protein", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/GO:0003700" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "TetR protein" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "TetR" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "TetR_protein" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/col1", - "http://sbols.org/v3#member" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_protein" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_protein" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "col1" - } ], - "@type" : [ "http://sbols.org/v3#Collection" ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/col1","http://sbols.org/v3#member":[{"@id":"https://sbolstandard.org/examples/LacI_protein"},{"@id":"https://sbolstandard.org/examples/TetR_protein"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"col1"}],"@type":["http://sbols.org/v3#Collection"]},{"@id":"https://sbolstandard.org/examples/LacI_protein","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#description":[{"@value":"LacI protein"}],"http://sbols.org/v3#name":[{"@value":"LacI"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#displayId":[{"@value":"LacI_protein"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_protein","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#description":[{"@value":"TetR protein"}],"http://sbols.org/v3#name":[{"@value":"TetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#displayId":[{"@value":"TetR_protein"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/collection/collection.nt b/SBOL3/entity/collection/collection.nt index 033a61d..88e1048 100644 --- a/SBOL3/entity/collection/collection.nt +++ b/SBOL3/entity/collection/collection.nt @@ -3,13 +3,6 @@ . "col1" . . - . - "LacI protein" . - "LacI" . - . - . - "LacI_protein" . - . . "TetR protein" . "TetR" . @@ -17,3 +10,10 @@ . "TetR_protein" . . + . + "LacI protein" . + "LacI" . + . + . + "LacI_protein" . + . diff --git a/SBOL3/entity/collection/collection.rdf b/SBOL3/entity/collection/collection.rdf index cef549a..b4714c6 100644 --- a/SBOL3/entity/collection/collection.rdf +++ b/SBOL3/entity/collection/collection.rdf @@ -20,14 +20,6 @@ col1 - - - LacI protein - LacI - - - LacI_protein - TetR protein @@ -36,4 +28,12 @@ TetR_protein + + + LacI protein + LacI + + + LacI_protein + diff --git a/SBOL3/entity/collection/collection.rj b/SBOL3/entity/collection/collection.rj index 84e9754..0df7b04 100644 --- a/SBOL3/entity/collection/collection.rj +++ b/SBOL3/entity/collection/collection.rj @@ -1,45 +1,55 @@ { - "https://sbolstandard.org/examples/col1" : { + "https://sbolstandard.org/examples/TetR_protein" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "col1" + "value" : "TetR_protein" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Collection" + "value" : "https://identifiers.org/GO:0003700" } ] , - "http://sbols.org/v3#member" : [ { + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "TetR protein" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_protein" + "value" : "https://sbolstandard.org/examples" } - , { + ] , + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_protein" + "value" : "https://identifiers.org/SBO:0000252" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "TetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/LacI_protein" : { + "https://sbolstandard.org/examples/col1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "LacI_protein" + "value" : "col1" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#member" : [ { "type" : "uri" , - "value" : "https://identifiers.org/GO:0003700" + "value" : "https://sbolstandard.org/examples/TetR_protein" } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + , { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/LacI_protein" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -47,27 +57,17 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "LacI" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "LacI protein" - } - ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Collection" } ] } , - "https://sbolstandard.org/examples/TetR_protein" : { + "https://sbolstandard.org/examples/LacI_protein" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "TetR_protein" + "value" : "LacI_protein" } ] , "http://sbols.org/v3#role" : [ { @@ -75,9 +75,9 @@ "value" : "https://identifiers.org/GO:0003700" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "LacI protein" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -85,19 +85,19 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "TetR" + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000252" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "TetR protein" + "value" : "LacI" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Component" } ] } diff --git a/SBOL3/entity/collection/collection.ttl b/SBOL3/entity/collection/collection.ttl index 93c841d..54d78b0 100644 --- a/SBOL3/entity/collection/collection.ttl +++ b/SBOL3/entity/collection/collection.ttl @@ -1,31 +1,31 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: -:col1 a sbol:Collection ; - sbol:displayId "col1" ; - sbol:hasNamespace ; +:col1 a sbol:Collection; + sbol:displayId "col1"; + sbol:hasNamespace ; sbol:member :LacI_protein , :TetR_protein . -:LacI_protein a sbol:Component ; - sbol:description "LacI protein" ; - sbol:displayId "LacI_protein" ; - sbol:hasNamespace ; - sbol:name "LacI" ; - sbol:role GO:0003700 ; +:TetR_protein a sbol:Component; + sbol:description "TetR protein"; + sbol:displayId "TetR_protein"; + sbol:hasNamespace ; + sbol:name "TetR"; + sbol:role GO:0003700; sbol:type SBO:0000252 . -:TetR_protein a sbol:Component ; - sbol:description "TetR protein" ; - sbol:displayId "TetR_protein" ; - sbol:hasNamespace ; - sbol:name "TetR" ; - sbol:role GO:0003700 ; +:LacI_protein a sbol:Component; + sbol:description "LacI protein"; + sbol:displayId "LacI_protein"; + sbol:hasNamespace ; + sbol:name "LacI"; + sbol:role GO:0003700; sbol:type SBO:0000252 . diff --git a/SBOL3/entity/combinatorialderivation/combinatorialderivation.jsonld b/SBOL3/entity/combinatorialderivation/combinatorialderivation.jsonld new file mode 100644 index 0000000..684f8f8 --- /dev/null +++ b/SBOL3/entity/combinatorialderivation/combinatorialderivation.jsonld @@ -0,0 +1,126 @@ +{ + "@graph": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_start", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_start_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000804" + }, + "sbol:description": "promoter_start", + "sbol:name": "pTetR_start", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "BBa_R0040_start", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_start_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "tccctat", + "sbol:description": "BBa_R0040_start sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "BBa_R0040_start_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/cs1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:template": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040" + }, + "sbol:displayId": "cs1", + "@type": "sbol:CombinatorialDerivation" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040", + "sbol:description": "TetR repressible promoter", + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:displayId": "BBa_R0040", + "sbol:hasFeature": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040/SubComponent3" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040/SubComponent2" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040/SubComponent1" + } + ], + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:name": "pTetR", + "@type": "sbol:Component", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + } + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_start" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040/SubComponent3", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_start" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040/SubComponent2", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_start" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac", + "sbol:description": "BBa_R0040 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "BBa_R0040_Sequence1", + "@type": "sbol:Sequence" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/combinatorialderivation/combinatorialderivation.jsonld_expanded b/SBOL3/entity/combinatorialderivation/combinatorialderivation.jsonld_expanded new file mode 100644 index 0000000..fadbe18 --- /dev/null +++ b/SBOL3/entity/combinatorialderivation/combinatorialderivation.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040_start","http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040_start_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000804"}],"http://sbols.org/v3#description":[{"@value":"promoter_start"}],"http://sbols.org/v3#name":[{"@value":"pTetR_start"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_R0040_start"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/BBa_R0040_start_Sequence1","http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"tccctat"}],"http://sbols.org/v3#description":[{"@value":"BBa_R0040_start sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_R0040_start_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/cs1","http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#template":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040"}],"http://sbols.org/v3#displayId":[{"@value":"cs1"}],"@type":["http://sbols.org/v3#CombinatorialDerivation"]},{"@id":"https://synbiohub.org/public/igem/BBa_R0040","http://sbols.org/v3#description":[{"@value":"TetR repressible promoter"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000167"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_R0040"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040/SubComponent3"},{"@id":"https://synbiohub.org/public/igem/BBa_R0040/SubComponent2"},{"@id":"https://synbiohub.org/public/igem/BBa_R0040/SubComponent1"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#name":[{"@value":"pTetR"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040_Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}]},{"@id":"https://synbiohub.org/public/igem/BBa_R0040/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040_start"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/BBa_R0040/SubComponent3","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040_start"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/BBa_R0040/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040_start"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/BBa_R0040_Sequence1","http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac"}],"http://sbols.org/v3#description":[{"@value":"BBa_R0040 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_R0040_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]}]} \ No newline at end of file diff --git a/SBOL3/entity/combinatorialderivation/combinatorialderivation.nt b/SBOL3/entity/combinatorialderivation/combinatorialderivation.nt new file mode 100644 index 0000000..b061363 --- /dev/null +++ b/SBOL3/entity/combinatorialderivation/combinatorialderivation.nt @@ -0,0 +1,46 @@ + . + . + "promoter_start" . + "pTetR_start" . + . + . + "BBa_R0040_start" . + . + . + . + "cs1" . + . + . + "SubComponent1" . + . + . + "SubComponent3" . + . + . + "tccctat" . + "BBa_R0040_start sequence" . + "Sequence1" . + . + "BBa_R0040_start_Sequence1" . + . + . + "SubComponent2" . + . + . + "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" . + "BBa_R0040 sequence" . + "Sequence1" . + . + "BBa_R0040_Sequence1" . + . + "TetR repressible promoter" . + . + "BBa_R0040" . + . + . + . + "pTetR" . + . + . + . + . diff --git a/SBOL3/entity/combinatorialderivation/combinatorialderivation.rdf b/SBOL3/entity/combinatorialderivation/combinatorialderivation.rdf new file mode 100644 index 0000000..b2ca1d2 --- /dev/null +++ b/SBOL3/entity/combinatorialderivation/combinatorialderivation.rdf @@ -0,0 +1,74 @@ + + + + + + + promoter_start + pTetR_start + + + BBa_R0040_start + + + TetR repressible promoter + + BBa_R0040 + + + + SubComponent3 + + + + + + + SubComponent2 + + + pTetR + + + + + + + + SubComponent1 + + + + + + tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac + BBa_R0040 sequence + Sequence1 + + BBa_R0040_Sequence1 + + + + tccctat + BBa_R0040_start sequence + Sequence1 + + BBa_R0040_start_Sequence1 + + + + + cs1 + + diff --git a/SBOL3/entity/combinatorialderivation/combinatorialderivation.rj b/SBOL3/entity/combinatorialderivation/combinatorialderivation.rj new file mode 100644 index 0000000..2da8131 --- /dev/null +++ b/SBOL3/entity/combinatorialderivation/combinatorialderivation.rj @@ -0,0 +1,253 @@ +{ + "https://synbiohub.org/public/igem/BBa_R0040/SubComponent3" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent3" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040_start" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_R0040/SubComponent2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent2" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040_start" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_R0040/SubComponent1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040_start" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/cs1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "cs1" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#template" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#CombinatorialDerivation" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_R0040_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "BBa_R0040 sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_R0040_start" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_R0040_start" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000804" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "promoter_start" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040_start_Sequence1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "pTetR_start" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_R0040_start_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_R0040_start_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "tccctat" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "BBa_R0040_start sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_R0040" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_R0040" + } + ] , + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040/SubComponent3" + } + , { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040/SubComponent2" + } + , { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040/SubComponent1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000167" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "TetR repressible promoter" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "pTetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } +} diff --git a/SBOL3/entity/combinatorialderivation/combinatorialderivation.ttl b/SBOL3/entity/combinatorialderivation/combinatorialderivation.ttl new file mode 100644 index 0000000..f4e7a1e --- /dev/null +++ b/SBOL3/entity/combinatorialderivation/combinatorialderivation.ttl @@ -0,0 +1,66 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + +:BBa_R0040_start a sbol:Component; + sbol:description "promoter_start"; + sbol:displayId "BBa_R0040_start"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :BBa_R0040_start_Sequence1; + sbol:name "pTetR_start"; + sbol:role SO:0000804; + sbol:type SBO:0000251 . + +:cs1 a sbol:CombinatorialDerivation; + sbol:displayId "cs1"; + sbol:hasNamespace <../igem>; + sbol:template :BBa_R0040 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :BBa_R0040_start . + + + a sbol:SubComponent; + sbol:displayId "SubComponent3"; + sbol:instanceOf :BBa_R0040_start . + +:BBa_R0040_start_Sequence1 + a sbol:Sequence; + sbol:description "BBa_R0040_start sequence"; + sbol:displayId "BBa_R0040_start_Sequence1"; + sbol:elements "tccctat"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . + + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :BBa_R0040_start . + +:BBa_R0040_Sequence1 a sbol:Sequence; + sbol:description "BBa_R0040 sequence"; + sbol:displayId "BBa_R0040_Sequence1"; + sbol:elements "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . + +:BBa_R0040 a sbol:Component; + sbol:description "TetR repressible promoter"; + sbol:displayId "BBa_R0040"; + sbol:hasFeature , , ; + sbol:hasNamespace <../igem>; + sbol:hasSequence :BBa_R0040_Sequence1; + sbol:name "pTetR"; + sbol:role SO:0000167; + sbol:type SBO:0000251 . diff --git a/SBOL3/entity/combinatorialderivation/combinatorialderivation_ordered.nt b/SBOL3/entity/combinatorialderivation/combinatorialderivation_ordered.nt new file mode 100644 index 0000000..c8e7fba --- /dev/null +++ b/SBOL3/entity/combinatorialderivation/combinatorialderivation_ordered.nt @@ -0,0 +1,46 @@ + "SubComponent1" . + . + . + "SubComponent2" . + . + . + "SubComponent3" . + . + . + "TetR repressible promoter" . + "BBa_R0040" . + . + . + . + . + . + "pTetR" . + . + . + . + "BBa_R0040 sequence" . + "BBa_R0040_Sequence1" . + "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" . + . + . + "Sequence1" . + . + "promoter_start" . + "BBa_R0040_start" . + . + . + "pTetR_start" . + . + . + . + "BBa_R0040_start sequence" . + "BBa_R0040_start_Sequence1" . + "tccctat" . + . + . + "Sequence1" . + . + "cs1" . + . + . + . diff --git a/SBOL3/entity/component/component.jsonld b/SBOL3/entity/component/component.jsonld new file mode 100644 index 0000000..5f42480 --- /dev/null +++ b/SBOL3/entity/component/component.jsonld @@ -0,0 +1,26 @@ +{ + "@id": "https://synbiohub.org/public/igem/BBa_F2620", + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:description": "PoPS Receiver", + "sbol:name": "BBa_F2620", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "BBa_F2620", + "@type": "sbol:Component", + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/component/component.jsonld_expanded b/SBOL3/entity/component/component.jsonld_expanded new file mode 100644 index 0000000..dc8a355 --- /dev/null +++ b/SBOL3/entity/component/component.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://synbiohub.org/public/igem/BBa_F2620","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#description":[{"@value":"PoPS Receiver"}],"http://sbols.org/v3#name":[{"@value":"BBa_F2620"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_F2620"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/component/component.nt b/SBOL3/entity/component/component.nt new file mode 100644 index 0000000..8ce0627 --- /dev/null +++ b/SBOL3/entity/component/component.nt @@ -0,0 +1,7 @@ + . + "PoPS Receiver" . + "BBa_F2620" . + . + . + "BBa_F2620" . + . diff --git a/SBOL3/entity/component/component.rdf b/SBOL3/entity/component/component.rdf new file mode 100644 index 0000000..f91baf5 --- /dev/null +++ b/SBOL3/entity/component/component.rdf @@ -0,0 +1,21 @@ + + + + PoPS Receiver + BBa_F2620 + + + BBa_F2620 + + diff --git a/SBOL3/entity/component/component.rj b/SBOL3/entity/component/component.rj new file mode 100644 index 0000000..dd183f4 --- /dev/null +++ b/SBOL3/entity/component/component.rj @@ -0,0 +1,39 @@ +{ + "https://synbiohub.org/public/igem/BBa_F2620" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_F2620" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "PoPS Receiver" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "BBa_F2620" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } +} diff --git a/SBOL3/entity/component/component.ttl b/SBOL3/entity/component/component.ttl new file mode 100644 index 0000000..fe64e32 --- /dev/null +++ b/SBOL3/entity/component/component.ttl @@ -0,0 +1,18 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + +:BBa_F2620 a sbol:Component; + sbol:description "PoPS Receiver"; + sbol:displayId "BBa_F2620"; + sbol:hasNamespace <../igem>; + sbol:name "BBa_F2620"; + sbol:role SO:0000704; + sbol:type SBO:0000251 . diff --git a/SBOL3/entity/component/component_ordered.nt b/SBOL3/entity/component/component_ordered.nt new file mode 100644 index 0000000..af41ee2 --- /dev/null +++ b/SBOL3/entity/component/component_ordered.nt @@ -0,0 +1,7 @@ + "PoPS Receiver" . + "BBa_F2620" . + . + "BBa_F2620" . + . + . + . diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld b/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld index efd7eea..367b2ec 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld @@ -1,8 +1,8 @@ { - "@id": "urn:uuid:a795cdd2-c23e-4003-a8e9-b603afaaadf1", + "@id": "urn:uuid:c75fa522-daae-4b85-8ed1-21ad3a15af24", "sbol:name": "TetR", "sbol:hasNamespace": { - "@id": "urn:uuid:0cb87e4e-ed33-4485-b7a3-26ad6c3fad5f" + "@id": "urn:uuid:193a1ac3-3181-4d93-98c3-a8ea4766e635" }, "sbol:type": { "@id": "SBO:0000252" diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld_expanded b/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld_expanded index 5fe226d..d64fa39 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld_expanded +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.jsonld_expanded @@ -1,13 +1 @@ -[ { - "@id" : "urn:uuid:a795cdd2-c23e-4003-a8e9-b603afaaadf1", - "http://sbols.org/v3#name" : [ { - "@value" : "TetR" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "urn:uuid:0cb87e4e-ed33-4485-b7a3-26ad6c3fad5f" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -} ] +{"@graph":[{"@id":"urn:uuid:c75fa522-daae-4b85-8ed1-21ad3a15af24","http://sbols.org/v3#name":[{"@value":"TetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"urn:uuid:193a1ac3-3181-4d93-98c3-a8ea4766e635"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.nt b/SBOL3/entity/component_urn_uri/component_urn_uri.nt index 1b4b831..afc2d58 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.nt +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.nt @@ -1,4 +1,4 @@ - "TetR" . - . - . - . + "TetR" . + . + . + . diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.rdf b/SBOL3/entity/component_urn_uri/component_urn_uri.rdf index 087b650..76799b2 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.rdf +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.rdf @@ -10,9 +10,9 @@ xmlns="https://sbolstandard.org/examples/" xmlns:om="http://www.ontology-of-units-of-measure.org/resource/om-2/" xml:base="https://sbolstandard.org/examples/"> - + TetR - + diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.rj b/SBOL3/entity/component_urn_uri/component_urn_uri.rj index b791bb6..b98f63c 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.rj +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.rj @@ -1,13 +1,13 @@ { - "urn:uuid:a795cdd2-c23e-4003-a8e9-b603afaaadf1" : { - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "urn:uuid:c75fa522-daae-4b85-8ed1-21ad3a15af24" : { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "urn:uuid:193a1ac3-3181-4d93-98c3-a8ea4766e635" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "urn:uuid:0cb87e4e-ed33-4485-b7a3-26ad6c3fad5f" + "value" : "https://identifiers.org/SBO:0000252" } ] , "http://sbols.org/v3#name" : [ { @@ -15,9 +15,9 @@ "value" : "TetR" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Component" } ] } diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri.ttl b/SBOL3/entity/component_urn_uri/component_urn_uri.ttl index 2cfdc43..410c188 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri.ttl +++ b/SBOL3/entity/component_urn_uri/component_urn_uri.ttl @@ -1,16 +1,16 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: - - a sbol:Component ; - sbol:hasNamespace ; - sbol:name "TetR" ; + + a sbol:Component; + sbol:hasNamespace ; + sbol:name "TetR"; sbol:type SBO:0000252 . diff --git a/SBOL3/entity/component_urn_uri/component_urn_uri_ordered.nt b/SBOL3/entity/component_urn_uri/component_urn_uri_ordered.nt index 5c8d283..0e18560 100644 --- a/SBOL3/entity/component_urn_uri/component_urn_uri_ordered.nt +++ b/SBOL3/entity/component_urn_uri/component_urn_uri_ordered.nt @@ -1,4 +1,4 @@ - . - "TetR" . - . - . + . + "TetR" . + . + . diff --git a/SBOL3/entity/componentreference/componentreference.jsonld b/SBOL3/entity/componentreference/componentreference.jsonld new file mode 100644 index 0000000..5ecfd91 --- /dev/null +++ b/SBOL3/entity/componentreference/componentreference.jsonld @@ -0,0 +1,175 @@ +{ + "@graph": [ + { + "@id": "https://synbiohub.org/public/igem/simpleDevice_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "", + "sbol:description": "simpleDevice sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "simpleDevice_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/i13504_system" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system", + "sbol:hasFeature": { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + }, + "sbol:role": [ + { + "@id": "SO:0000704" + }, + { + "@id": "SBO:0000289" + } + ], + "sbol:name": "i13504 system", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "i13504_system", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504", + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "i13504", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/B0015_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", + "sbol:description": "B0015 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "B0015_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1", + "sbol:hasFeature": [ + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + } + ], + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "interlab16device1", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1", + "sbol:inChildOf": { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + }, + "sbol:refersTo": { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://synbiohub.org/public/igem/B0015", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/B0015_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:description": "B0015 double terminator", + "sbol:name": "terminator", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "B0015", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/simpleDevice/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/B0015" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/i13504" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/simpleDevice", + "sbol:hasFeature": { + "@id": "https://synbiohub.org/public/igem/simpleDevice/SubComponent1" + }, + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/simpleDevice_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "simpleDevice", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/componentreference/componentreference.jsonld_expanded b/SBOL3/entity/componentreference/componentreference.jsonld_expanded new file mode 100644 index 0000000..74d5391 --- /dev/null +++ b/SBOL3/entity/componentreference/componentreference.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://synbiohub.org/public/igem/simpleDevice_Sequence1","http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":""}],"http://sbols.org/v3#description":[{"@value":"simpleDevice sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"simpleDevice_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/i13504_system"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/i13504_system","http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"},{"@id":"https://identifiers.org/SBO:0000289"}],"http://sbols.org/v3#name":[{"@value":"i13504 system"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"i13504_system"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/i13504","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"i13504"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/B0015_Sequence1","http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"}],"http://sbols.org/v3#description":[{"@value":"B0015 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"B0015_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/interlab16device1","http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/ComponentReference1"},{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"interlab16device1"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/interlab16device1/ComponentReference1","http://sbols.org/v3#inChildOf":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent1"}],"http://sbols.org/v3#refersTo":[{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference1"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://synbiohub.org/public/igem/B0015","http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/B0015_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#description":[{"@value":"B0015 double terminator"}],"http://sbols.org/v3#name":[{"@value":"terminator"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"B0015"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/simpleDevice/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/B0015"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/i13504"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/simpleDevice","http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/simpleDevice/SubComponent1"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/simpleDevice_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"simpleDevice"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/componentreference/componentreference.nt b/SBOL3/entity/componentreference/componentreference.nt new file mode 100644 index 0000000..711e221 --- /dev/null +++ b/SBOL3/entity/componentreference/componentreference.nt @@ -0,0 +1,62 @@ + . + "" . + "simpleDevice sequence" . + "Sequence1" . + . + "simpleDevice_Sequence1" . + . + . + "SubComponent1" . + . + . + . + . + "i13504" . + . + . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + "B0015 sequence" . + "Sequence1" . + . + "B0015_Sequence1" . + . + . + . + . + . + . + "interlab16device1" . + . + . + . + "B0015 double terminator" . + "terminator" . + . + . + "B0015" . + . + . + "SubComponent1" . + . + . + . + "ComponentReference1" . + . + . + . + . + . + . + "simpleDevice" . + . + . + "SubComponent1" . + . + . + . + . + "i13504 system" . + . + . + "i13504_system" . + . diff --git a/SBOL3/entity/componentreference/componentreference.rdf b/SBOL3/entity/componentreference/componentreference.rdf new file mode 100644 index 0000000..3434b1d --- /dev/null +++ b/SBOL3/entity/componentreference/componentreference.rdf @@ -0,0 +1,98 @@ + + + + + + i13504 + + + + + + + + + + SubComponent1 + + + + + + SubComponent1 + + + ComponentReference1 + + + + + + + interlab16device1 + + + + + + i13504 system + + + i13504_system + + + + + + + + SubComponent1 + + + + + + + + + simpleDevice + + + + + + + B0015 double terminator + terminator + + + B0015 + + + + ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc + B0015 sequence + Sequence1 + + B0015_Sequence1 + + + + + simpleDevice sequence + Sequence1 + + simpleDevice_Sequence1 + + diff --git a/SBOL3/entity/componentreference/componentreference.rj b/SBOL3/entity/componentreference/componentreference.rj new file mode 100644 index 0000000..81ce6d5 --- /dev/null +++ b/SBOL3/entity/componentreference/componentreference.rj @@ -0,0 +1,342 @@ +{ + "https://synbiohub.org/public/igem/B0015_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "B0015_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "B0015 sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504_system/SubComponent1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://synbiohub.org/public/igem/interlab16device1" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + } + , { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "interlab16device1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504_system" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504_system" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + , { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000289" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "i13504 system" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ComponentReference1" + } + ] , + "http://sbols.org/v3#inChildOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#ComponentReference" + } + ] , + "http://sbols.org/v3#refersTo" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + } + ] + } + , + "https://synbiohub.org/public/igem/simpleDevice_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "simpleDevice_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "simpleDevice sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://synbiohub.org/public/igem/simpleDevice/SubComponent1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/B0015" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/simpleDevice" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/simpleDevice/SubComponent1" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "simpleDevice" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/simpleDevice_Sequence1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_system" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/B0015" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "B0015" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000141" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "B0015 double terminator" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/B0015_Sequence1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "terminator" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } +} diff --git a/SBOL3/entity/componentreference/componentreference.ttl b/SBOL3/entity/componentreference/componentreference.ttl new file mode 100644 index 0000000..3d2f6dc --- /dev/null +++ b/SBOL3/entity/componentreference/componentreference.ttl @@ -0,0 +1,86 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + +:simpleDevice_Sequence1 + a sbol:Sequence; + sbol:description "simpleDevice sequence"; + sbol:displayId "simpleDevice_Sequence1"; + sbol:elements ""; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :i13504_system . + +:i13504 a sbol:Component; + sbol:displayId "i13504"; + sbol:hasNamespace <../igem>; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + +:B0015_Sequence1 a sbol:Sequence; + sbol:description "B0015 sequence"; + sbol:displayId "B0015_Sequence1"; + sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . + +:interlab16device1 a sbol:Component; + sbol:displayId "interlab16device1"; + sbol:hasFeature , ; + sbol:hasNamespace <../igem>; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + +:B0015 a sbol:Component; + sbol:description "B0015 double terminator"; + sbol:displayId "B0015"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :B0015_Sequence1; + sbol:name "terminator"; + sbol:role SO:0000141; + sbol:type SBO:0000251 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :B0015 . + + + a sbol:ComponentReference; + sbol:displayId "ComponentReference1"; + sbol:inChildOf ; + sbol:refersTo . + +:simpleDevice a sbol:Component; + sbol:displayId "simpleDevice"; + sbol:hasFeature ; + sbol:hasNamespace <../igem>; + sbol:hasSequence :simpleDevice_Sequence1; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :i13504 . + +:i13504_system a sbol:Component; + sbol:displayId "i13504_system"; + sbol:hasFeature ; + sbol:hasNamespace <../igem>; + sbol:name "i13504 system"; + sbol:role SO:0000704 , SBO:0000289; + sbol:type SBO:0000251 . diff --git a/SBOL3/entity/componentreference/componentreference_ordered.nt b/SBOL3/entity/componentreference/componentreference_ordered.nt new file mode 100644 index 0000000..66b8a96 --- /dev/null +++ b/SBOL3/entity/componentreference/componentreference_ordered.nt @@ -0,0 +1,62 @@ + "B0015 double terminator" . + "B0015" . + . + . + "terminator" . + . + . + . + "B0015 sequence" . + "B0015_Sequence1" . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + . + . + "Sequence1" . + . + "i13504" . + . + . + . + . + "SubComponent1" . + . + . + "i13504_system" . + . + . + "i13504 system" . + . + . + . + . + "ComponentReference1" . + . + . + . + "SubComponent1" . + . + . + "interlab16device1" . + . + . + . + . + . + . + "SubComponent1" . + . + . + "simpleDevice" . + . + . + . + . + . + . + "simpleDevice sequence" . + "simpleDevice_Sequence1" . + "" . + . + . + "Sequence1" . + . diff --git a/SBOL3/entity/constraint/constraint.jsonld b/SBOL3/entity/constraint/constraint.jsonld new file mode 100644 index 0000000..ea65d20 --- /dev/null +++ b/SBOL3/entity/constraint/constraint.jsonld @@ -0,0 +1,139 @@ +{ + "@graph": [ + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/i13504_system" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system", + "sbol:hasFeature": { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + }, + "sbol:role": { + "@id": "SBO:0000289" + }, + "sbol:name": "i13504 system", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:displayId": "i13504_system", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/j23101", + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "j23101", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/Constraint1", + "sbol:object": { + "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + }, + "sbol:subject": { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" + }, + "sbol:restriction": { + "@id": "sbol:meets" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1", + "sbol:inChildOf": { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + }, + "sbol:refersTo": { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent2", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/j23101" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504", + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:description": "Screening plasmid intermediate", + "sbol:name": "i13504", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "i13504", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1", + "sbol:hasConstraint": { + "@id": "https://synbiohub.org/public/igem/interlab16device1/Constraint1" + }, + "sbol:hasFeature": [ + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + }, + { + "@id": "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + } + ], + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "interlab16device1", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_system/SubComponent1", + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/i13504" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/constraint/constraint.jsonld_expanded b/SBOL3/entity/constraint/constraint.jsonld_expanded new file mode 100644 index 0000000..33c9b35 --- /dev/null +++ b/SBOL3/entity/constraint/constraint.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/i13504_system"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/i13504_system","http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000289"}],"http://sbols.org/v3#name":[{"@value":"i13504 system"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#displayId":[{"@value":"i13504_system"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/j23101","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"j23101"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/interlab16device1/Constraint1","http://sbols.org/v3#object":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/ComponentReference1"}],"http://sbols.org/v3#subject":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent2"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#meets"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint1"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://synbiohub.org/public/igem/interlab16device1/ComponentReference1","http://sbols.org/v3#inChildOf":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent1"}],"http://sbols.org/v3#refersTo":[{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference1"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/j23101"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/i13504","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#description":[{"@value":"Screening plasmid intermediate"}],"http://sbols.org/v3#name":[{"@value":"i13504"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"i13504"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/interlab16device1","http://sbols.org/v3#hasConstraint":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/Constraint1"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent2"},{"@id":"https://synbiohub.org/public/igem/interlab16device1/ComponentReference1"},{"@id":"https://synbiohub.org/public/igem/interlab16device1/SubComponent1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"interlab16device1"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/i13504_system/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/i13504"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]}]} \ No newline at end of file diff --git a/SBOL3/entity/constraint/constraint.nt b/SBOL3/entity/constraint/constraint.nt new file mode 100644 index 0000000..a4e1cc2 --- /dev/null +++ b/SBOL3/entity/constraint/constraint.nt @@ -0,0 +1,46 @@ + . + "SubComponent1" . + . + . + . + . + "j23101" . + . + . + . + . + "Constraint1" . + . + . + "Screening plasmid intermediate" . + "i13504" . + . + . + "i13504" . + . + . + . + . + . + . + . + . + "interlab16device1" . + . + . + . + "ComponentReference1" . + . + . + "SubComponent2" . + . + . + "SubComponent1" . + . + . + . + "i13504 system" . + . + . + "i13504_system" . + . diff --git a/SBOL3/entity/constraint/constraint.rdf b/SBOL3/entity/constraint/constraint.rdf new file mode 100644 index 0000000..6d154e8 --- /dev/null +++ b/SBOL3/entity/constraint/constraint.rdf @@ -0,0 +1,75 @@ + + + + + + j23101 + + + + Screening plasmid intermediate + i13504 + + + i13504 + + + + + + + + + + + + SubComponent1 + + + + + + SubComponent1 + + + ComponentReference1 + + + + + + SubComponent2 + + + + Constraint1 + + + + + + + + + interlab16device1 + + + + + i13504 system + + + i13504_system + + diff --git a/SBOL3/entity/constraint/constraint.rj b/SBOL3/entity/constraint/constraint.rj new file mode 100644 index 0000000..9b5a7da --- /dev/null +++ b/SBOL3/entity/constraint/constraint.rj @@ -0,0 +1,256 @@ +{ + "https://synbiohub.org/public/igem/j23101" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "j23101" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504_system/SubComponent1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Screening plasmid intermediate" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "i13504" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://synbiohub.org/public/igem/interlab16device1" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + } + , { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" + } + , { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "interlab16device1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#hasConstraint" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/Constraint1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504_system" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504_system" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000289" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000241" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "i13504 system" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ComponentReference1" + } + ] , + "http://sbols.org/v3#inChildOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#ComponentReference" + } + ] , + "http://sbols.org/v3#refersTo" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_system/SubComponent1" + } + ] + } + , + "https://synbiohub.org/public/igem/interlab16device1/Constraint1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Constraint1" + } + ] , + "http://sbols.org/v3#subject" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" + } + ] , + "http://sbols.org/v3#restriction" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#meets" + } + ] , + "http://sbols.org/v3#object" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/interlab16device1/ComponentReference1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Constraint" + } + ] + } + , + "https://synbiohub.org/public/igem/interlab16device1/SubComponent2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent2" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/j23101" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/interlab16device1/SubComponent1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_system" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } +} diff --git a/SBOL3/entity/constraint/constraint.ttl b/SBOL3/entity/constraint/constraint.ttl new file mode 100644 index 0000000..9d4ba1b --- /dev/null +++ b/SBOL3/entity/constraint/constraint.ttl @@ -0,0 +1,68 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :i13504_system . + +:j23101 a sbol:Component; + sbol:displayId "j23101"; + sbol:hasNamespace <../igem>; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + + + a sbol:Constraint; + sbol:displayId "Constraint1"; + sbol:object ; + sbol:restriction sbol:meets; + sbol:subject . + +:i13504 a sbol:Component; + sbol:description "Screening plasmid intermediate"; + sbol:displayId "i13504"; + sbol:hasNamespace <../igem>; + sbol:name "i13504"; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + +:interlab16device1 a sbol:Component; + sbol:displayId "interlab16device1"; + sbol:hasConstraint ; + sbol:hasFeature , , ; + sbol:hasNamespace <../igem>; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + + + a sbol:ComponentReference; + sbol:displayId "ComponentReference1"; + sbol:inChildOf ; + sbol:refersTo . + + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :j23101 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :i13504 . + +:i13504_system a sbol:Component; + sbol:displayId "i13504_system"; + sbol:hasFeature ; + sbol:hasNamespace <../igem>; + sbol:name "i13504 system"; + sbol:role SBO:0000289; + sbol:type SBO:0000241 . diff --git a/SBOL3/entity/constraint/constraint_ordered.nt b/SBOL3/entity/constraint/constraint_ordered.nt new file mode 100644 index 0000000..f1445a1 --- /dev/null +++ b/SBOL3/entity/constraint/constraint_ordered.nt @@ -0,0 +1,46 @@ + "Screening plasmid intermediate" . + "i13504" . + . + "i13504" . + . + . + . + "SubComponent1" . + . + . + "i13504_system" . + . + . + "i13504 system" . + . + . + . + "ComponentReference1" . + . + . + . + "Constraint1" . + . + . + . + . + "SubComponent1" . + . + . + "SubComponent2" . + . + . + "interlab16device1" . + . + . + . + . + . + . + . + . + "j23101" . + . + . + . + . diff --git a/SBOL3/entity/cut/cut.jsonld b/SBOL3/entity/cut/cut.jsonld new file mode 100644 index 0000000..b168f1d --- /dev/null +++ b/SBOL3/entity/cut/cut.jsonld @@ -0,0 +1,67 @@ +{ + "@graph": [ + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040/SequenceFeature1/Cut1", + "sbol:at": "5", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" + }, + "sbol:displayId": "Cut1", + "@type": "sbol:Cut" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac", + "sbol:description": "BBa_R0040 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "BBa_R0040_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040/SequenceFeature1", + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040/SequenceFeature1/Cut1" + }, + "sbol:displayId": "SequenceFeature1", + "@type": "sbol:SequenceFeature" + }, + { + "@id": "https://synbiohub.org/public/igem/BBa_R0040", + "sbol:hasFeature": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040/SequenceFeature1" + }, + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:description": "TetR repressible promoter", + "sbol:name": "pTetR", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "BBa_R0040", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/cut/cut.jsonld_expanded b/SBOL3/entity/cut/cut.jsonld_expanded new file mode 100644 index 0000000..84cc6fa --- /dev/null +++ b/SBOL3/entity/cut/cut.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040/SequenceFeature1/Cut1","http://sbols.org/v3#at":[{"@value":"5"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040_Sequence1"}],"http://sbols.org/v3#displayId":[{"@value":"Cut1"}],"@type":["http://sbols.org/v3#Cut"]},{"@id":"https://synbiohub.org/public/igem/BBa_R0040_Sequence1","http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac"}],"http://sbols.org/v3#description":[{"@value":"BBa_R0040 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_R0040_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/BBa_R0040/SequenceFeature1","http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040/SequenceFeature1/Cut1"}],"http://sbols.org/v3#displayId":[{"@value":"SequenceFeature1"}],"@type":["http://sbols.org/v3#SequenceFeature"]},{"@id":"https://synbiohub.org/public/igem/BBa_R0040","http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040/SequenceFeature1"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/BBa_R0040_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000167"}],"http://sbols.org/v3#description":[{"@value":"TetR repressible promoter"}],"http://sbols.org/v3#name":[{"@value":"pTetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"BBa_R0040"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/cut/cut.nt b/SBOL3/entity/cut/cut.nt new file mode 100644 index 0000000..3328760 --- /dev/null +++ b/SBOL3/entity/cut/cut.nt @@ -0,0 +1,23 @@ + "5" . + . + "Cut1" . + . + . + "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" . + "BBa_R0040 sequence" . + "Sequence1" . + . + "BBa_R0040_Sequence1" . + . + . + "SequenceFeature1" . + . + . + . + . + "TetR repressible promoter" . + "pTetR" . + . + . + "BBa_R0040" . + . diff --git a/SBOL3/entity/cut/cut.rdf b/SBOL3/entity/cut/cut.rdf new file mode 100644 index 0000000..bcebf65 --- /dev/null +++ b/SBOL3/entity/cut/cut.rdf @@ -0,0 +1,46 @@ + + + + + + + 5 + + + + Cut1 + + + SequenceFeature1 + + + + + + + TetR repressible promoter + pTetR + + + BBa_R0040 + + + + tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac + BBa_R0040 sequence + Sequence1 + + BBa_R0040_Sequence1 + + diff --git a/SBOL3/entity/cut/cut.rj b/SBOL3/entity/cut/cut.rj new file mode 100644 index 0000000..e32dcb3 --- /dev/null +++ b/SBOL3/entity/cut/cut.rj @@ -0,0 +1,128 @@ +{ + "https://synbiohub.org/public/igem/BBa_R0040/SequenceFeature1/Cut1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Cut1" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" + } + ] , + "http://sbols.org/v3#at" : [ { + "type" : "literal" , + "value" : "5" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Cut" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_R0040_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "BBa_R0040 sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_R0040/SequenceFeature1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SequenceFeature1" + } + ] , + "http://sbols.org/v3#hasLocation" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040/SequenceFeature1/Cut1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SequenceFeature" + } + ] + } + , + "https://synbiohub.org/public/igem/BBa_R0040" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040/SequenceFeature1" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "BBa_R0040" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000167" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "TetR repressible promoter" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/BBa_R0040_Sequence1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "pTetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } +} diff --git a/SBOL3/entity/cut/cut.ttl b/SBOL3/entity/cut/cut.ttl new file mode 100644 index 0000000..b3a577c --- /dev/null +++ b/SBOL3/entity/cut/cut.ttl @@ -0,0 +1,39 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + + + a sbol:Cut; + sbol:at "5"; + sbol:displayId "Cut1"; + sbol:hasSequence :BBa_R0040_Sequence1 . + +:BBa_R0040_Sequence1 a sbol:Sequence; + sbol:description "BBa_R0040 sequence"; + sbol:displayId "BBa_R0040_Sequence1"; + sbol:elements "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . + + + a sbol:SequenceFeature; + sbol:displayId "SequenceFeature1"; + sbol:hasLocation . + +:BBa_R0040 a sbol:Component; + sbol:description "TetR repressible promoter"; + sbol:displayId "BBa_R0040"; + sbol:hasFeature ; + sbol:hasNamespace <../igem>; + sbol:hasSequence :BBa_R0040_Sequence1; + sbol:name "pTetR"; + sbol:role SO:0000167; + sbol:type SBO:0000251 . diff --git a/SBOL3/entity/cut/cut_ordered.nt b/SBOL3/entity/cut/cut_ordered.nt new file mode 100644 index 0000000..7a1a591 --- /dev/null +++ b/SBOL3/entity/cut/cut_ordered.nt @@ -0,0 +1,23 @@ + "5" . + "Cut1" . + . + . + "SequenceFeature1" . + . + . + "TetR repressible promoter" . + "BBa_R0040" . + . + . + . + "pTetR" . + . + . + . + "BBa_R0040 sequence" . + "BBa_R0040_Sequence1" . + "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac" . + . + . + "Sequence1" . + . diff --git a/SBOL3/entity/experiment/experiment.jsonld b/SBOL3/entity/experiment/experiment.jsonld new file mode 100644 index 0000000..aeb9c4f --- /dev/null +++ b/SBOL3/entity/experiment/experiment.jsonld @@ -0,0 +1,52 @@ +{ + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/attachment1", + "sbol:source": { + "@id": "https://sbolstandard.org/attachment1" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "attachment1", + "@type": "sbol:Attachment" + }, + { + "@id": "https://sbolstandard.org/examples/attachment2", + "sbol:source": { + "@id": "https://sbolstandard.org/attachment2" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "attachment2", + "@type": "sbol:Attachment" + }, + { + "@id": "https://sbolstandard.org/examples/exp1", + "sbol:member": [ + { + "@id": "https://sbolstandard.org/examples/attachment2" + }, + { + "@id": "https://sbolstandard.org/examples/attachment1" + } + ], + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "exp1", + "@type": "sbol:Experiment" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/experiment/experiment.jsonld_expanded b/SBOL3/entity/experiment/experiment.jsonld_expanded new file mode 100644 index 0000000..430afbc --- /dev/null +++ b/SBOL3/entity/experiment/experiment.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://sbolstandard.org/examples/attachment1","http://sbols.org/v3#source":[{"@id":"https://sbolstandard.org/attachment1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"attachment1"}],"@type":["http://sbols.org/v3#Attachment"]},{"@id":"https://sbolstandard.org/examples/attachment2","http://sbols.org/v3#source":[{"@id":"https://sbolstandard.org/attachment2"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"attachment2"}],"@type":["http://sbols.org/v3#Attachment"]},{"@id":"https://sbolstandard.org/examples/exp1","http://sbols.org/v3#member":[{"@id":"https://sbolstandard.org/examples/attachment2"},{"@id":"https://sbolstandard.org/examples/attachment1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"exp1"}],"@type":["http://sbols.org/v3#Experiment"]}]} \ No newline at end of file diff --git a/SBOL3/entity/experiment/experiment.nt b/SBOL3/entity/experiment/experiment.nt new file mode 100644 index 0000000..ec19a2a --- /dev/null +++ b/SBOL3/entity/experiment/experiment.nt @@ -0,0 +1,13 @@ + . + . + "attachment1" . + . + . + . + "attachment2" . + . + . + . + . + "exp1" . + . diff --git a/SBOL3/entity/experiment/experiment.rdf b/SBOL3/entity/experiment/experiment.rdf new file mode 100644 index 0000000..c1981fe --- /dev/null +++ b/SBOL3/entity/experiment/experiment.rdf @@ -0,0 +1,29 @@ + + + + + attachment1 + + + + + attachment2 + + + + + + exp1 + + diff --git a/SBOL3/entity/experiment/experiment.rj b/SBOL3/entity/experiment/experiment.rj new file mode 100644 index 0000000..6275200 --- /dev/null +++ b/SBOL3/entity/experiment/experiment.rj @@ -0,0 +1,74 @@ +{ + "https://sbolstandard.org/examples/attachment1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "attachment1" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#source" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/attachment1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Attachment" + } + ] + } + , + "https://sbolstandard.org/examples/attachment2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "attachment2" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#source" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/attachment2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Attachment" + } + ] + } + , + "https://sbolstandard.org/examples/exp1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "exp1" + } + ] , + "http://sbols.org/v3#member" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/attachment1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/attachment2" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Experiment" + } + ] + } +} diff --git a/SBOL3/entity/experiment/experiment.ttl b/SBOL3/entity/experiment/experiment.ttl new file mode 100644 index 0000000..a74dd24 --- /dev/null +++ b/SBOL3/entity/experiment/experiment.ttl @@ -0,0 +1,25 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + +:attachment1 a sbol:Attachment; + sbol:displayId "attachment1"; + sbol:hasNamespace ; + sbol:source . + +:attachment2 a sbol:Attachment; + sbol:displayId "attachment2"; + sbol:hasNamespace ; + sbol:source . + +:exp1 a sbol:Experiment; + sbol:displayId "exp1"; + sbol:hasNamespace ; + sbol:member :attachment2 , :attachment1 . diff --git a/SBOL3/entity/experiment/experiment_ordered.nt b/SBOL3/entity/experiment/experiment_ordered.nt new file mode 100644 index 0000000..735f613 --- /dev/null +++ b/SBOL3/entity/experiment/experiment_ordered.nt @@ -0,0 +1,13 @@ + "attachment1" . + . + . + . + "attachment2" . + . + . + . + "exp1" . + . + . + . + . diff --git a/SBOL3/entity/externallydefined/externallydefined.jsonld b/SBOL3/entity/externallydefined/externallydefined.jsonld new file mode 100644 index 0000000..51654f0 --- /dev/null +++ b/SBOL3/entity/externallydefined/externallydefined.jsonld @@ -0,0 +1,55 @@ +{ + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/interlab16device1", + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/interlab16device1/ExternallyDefined2" + }, + { + "@id": "https://sbolstandard.org/examples/interlab16device1/ExternallyDefined1" + } + ], + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:displayId": "interlab16device1", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/interlab16device1/ExternallyDefined2", + "sbol:definition": { + "@id": "http://uniprot.org/rfp" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "ExternallyDefined2", + "@type": "sbol:ExternallyDefined" + }, + { + "@id": "https://sbolstandard.org/examples/interlab16device1/ExternallyDefined1", + "sbol:definition": { + "@id": "http://uniprot.org/gfp" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "ExternallyDefined1", + "@type": "sbol:ExternallyDefined" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/externallydefined/externallydefined.jsonld_expanded b/SBOL3/entity/externallydefined/externallydefined.jsonld_expanded new file mode 100644 index 0000000..56f0e9e --- /dev/null +++ b/SBOL3/entity/externallydefined/externallydefined.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://sbolstandard.org/examples/interlab16device1","http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/interlab16device1/ExternallyDefined2"},{"@id":"https://sbolstandard.org/examples/interlab16device1/ExternallyDefined1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#displayId":[{"@value":"interlab16device1"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/interlab16device1/ExternallyDefined2","http://sbols.org/v3#definition":[{"@id":"http://uniprot.org/rfp"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#displayId":[{"@value":"ExternallyDefined2"}],"@type":["http://sbols.org/v3#ExternallyDefined"]},{"@id":"https://sbolstandard.org/examples/interlab16device1/ExternallyDefined1","http://sbols.org/v3#definition":[{"@id":"http://uniprot.org/gfp"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#displayId":[{"@value":"ExternallyDefined1"}],"@type":["http://sbols.org/v3#ExternallyDefined"]}]} \ No newline at end of file diff --git a/SBOL3/entity/externallydefined/externallydefined.nt b/SBOL3/entity/externallydefined/externallydefined.nt new file mode 100644 index 0000000..aabb73c --- /dev/null +++ b/SBOL3/entity/externallydefined/externallydefined.nt @@ -0,0 +1,14 @@ + . + . + . + . + "interlab16device1" . + . + . + . + "ExternallyDefined1" . + . + . + . + "ExternallyDefined2" . + . diff --git a/SBOL3/entity/externallydefined/externallydefined.rdf b/SBOL3/entity/externallydefined/externallydefined.rdf new file mode 100644 index 0000000..7b3325b --- /dev/null +++ b/SBOL3/entity/externallydefined/externallydefined.rdf @@ -0,0 +1,32 @@ + + + + + + + ExternallyDefined2 + + + + + + + ExternallyDefined1 + + + + + interlab16device1 + + diff --git a/SBOL3/entity/externallydefined/externallydefined.rj b/SBOL3/entity/externallydefined/externallydefined.rj new file mode 100644 index 0000000..8556a31 --- /dev/null +++ b/SBOL3/entity/externallydefined/externallydefined.rj @@ -0,0 +1,79 @@ +{ + "https://sbolstandard.org/examples/interlab16device1" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/interlab16device1/ExternallyDefined1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/interlab16device1/ExternallyDefined2" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "interlab16device1" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000241" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/interlab16device1/ExternallyDefined1" : { + "http://sbols.org/v3#definition" : [ { + "type" : "uri" , + "value" : "http://uniprot.org/gfp" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ExternallyDefined1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#ExternallyDefined" + } + ] + } + , + "https://sbolstandard.org/examples/interlab16device1/ExternallyDefined2" : { + "http://sbols.org/v3#definition" : [ { + "type" : "uri" , + "value" : "http://uniprot.org/rfp" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ExternallyDefined2" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#ExternallyDefined" + } + ] + } +} diff --git a/SBOL3/entity/externallydefined/externallydefined.ttl b/SBOL3/entity/externallydefined/externallydefined.ttl new file mode 100644 index 0000000..d63ea01 --- /dev/null +++ b/SBOL3/entity/externallydefined/externallydefined.ttl @@ -0,0 +1,28 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + +:interlab16device1 a sbol:Component; + sbol:displayId "interlab16device1"; + sbol:hasFeature , ; + sbol:hasNamespace ; + sbol:type SBO:0000241 . + + + a sbol:ExternallyDefined; + sbol:definition ; + sbol:displayId "ExternallyDefined1"; + sbol:type SBO:0000252 . + + + a sbol:ExternallyDefined; + sbol:definition ; + sbol:displayId "ExternallyDefined2"; + sbol:type SBO:0000252 . diff --git a/SBOL3/entity/externallydefined/externallydefined_ordered.nt b/SBOL3/entity/externallydefined/externallydefined_ordered.nt new file mode 100644 index 0000000..e3f4af6 --- /dev/null +++ b/SBOL3/entity/externallydefined/externallydefined_ordered.nt @@ -0,0 +1,14 @@ + . + "ExternallyDefined1" . + . + . + . + "ExternallyDefined2" . + . + . + "interlab16device1" . + . + . + . + . + . diff --git a/SBOL3/entity/implementation/implementation.jsonld_expanded b/SBOL3/entity/implementation/implementation.jsonld_expanded index 9d57b6c..0b83e56 100644 --- a/SBOL3/entity/implementation/implementation.jsonld_expanded +++ b/SBOL3/entity/implementation/implementation.jsonld_expanded @@ -1,34 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/TetR_protein", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/GO:0003700" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "TetR protein" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "TetR" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "TetR_protein" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/impl1", - "http://sbols.org/v3#built" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_protein" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "impl1" - } ], - "@type" : [ "http://sbols.org/v3#Implementation" ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/impl1","http://sbols.org/v3#built":[{"@id":"https://sbolstandard.org/examples/TetR_protein"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"impl1"}],"@type":["http://sbols.org/v3#Implementation"]},{"@id":"https://sbolstandard.org/examples/TetR_protein","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#description":[{"@value":"TetR protein"}],"http://sbols.org/v3#name":[{"@value":"TetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#displayId":[{"@value":"TetR_protein"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/implementation/implementation.rj b/SBOL3/entity/implementation/implementation.rj index e4b7f7d..8d3484a 100644 --- a/SBOL3/entity/implementation/implementation.rj +++ b/SBOL3/entity/implementation/implementation.rj @@ -1,13 +1,18 @@ { - "https://sbolstandard.org/examples/impl1" : { + "https://sbolstandard.org/examples/TetR_protein" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "impl1" + "value" : "TetR_protein" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Implementation" + "value" : "https://identifiers.org/GO:0003700" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "TetR protein" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -15,47 +20,42 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#built" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_protein" - } - ] - } - , - "https://sbolstandard.org/examples/TetR_protein" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "TetR_protein" + "value" : "https://identifiers.org/SBO:0000252" } ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/GO:0003700" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "TetR" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Component" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + ] + } + , + "https://sbolstandard.org/examples/impl1" : { + "http://sbols.org/v3#built" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://sbolstandard.org/examples/TetR_protein" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "TetR" + "value" : "impl1" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "TetR protein" + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Implementation" } ] } diff --git a/SBOL3/entity/implementation/implementation.ttl b/SBOL3/entity/implementation/implementation.ttl index bed490a..bed1014 100644 --- a/SBOL3/entity/implementation/implementation.ttl +++ b/SBOL3/entity/implementation/implementation.ttl @@ -1,23 +1,23 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: -:impl1 a sbol:Implementation ; - sbol:built :TetR_protein ; - sbol:displayId "impl1" ; +:impl1 a sbol:Implementation; + sbol:built :TetR_protein; + sbol:displayId "impl1"; sbol:hasNamespace . -:TetR_protein a sbol:Component ; - sbol:description "TetR protein" ; - sbol:displayId "TetR_protein" ; - sbol:hasNamespace ; - sbol:name "TetR" ; - sbol:role GO:0003700 ; +:TetR_protein a sbol:Component; + sbol:description "TetR protein"; + sbol:displayId "TetR_protein"; + sbol:hasNamespace ; + sbol:name "TetR"; + sbol:role GO:0003700; sbol:type SBO:0000252 . diff --git a/SBOL3/entity/interaction/interaction.jsonld b/SBOL3/entity/interaction/interaction.jsonld new file mode 100644 index 0000000..c5a4471 --- /dev/null +++ b/SBOL3/entity/interaction/interaction.jsonld @@ -0,0 +1,40 @@ +{ + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction1", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system", + "sbol:hasInteraction": { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction1" + }, + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:name": "i13504 system", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "i13504_system", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/interaction/interaction.jsonld_expanded b/SBOL3/entity/interaction/interaction.jsonld_expanded new file mode 100644 index 0000000..91a9939 --- /dev/null +++ b/SBOL3/entity/interaction/interaction.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction1","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction1"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/i13504_system","http://sbols.org/v3#hasInteraction":[{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#name":[{"@value":"i13504 system"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"i13504_system"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/interaction/interaction.nt b/SBOL3/entity/interaction/interaction.nt new file mode 100644 index 0000000..c0026f0 --- /dev/null +++ b/SBOL3/entity/interaction/interaction.nt @@ -0,0 +1,10 @@ + . + "Interaction1" . + . + . + . + "i13504 system" . + . + . + "i13504_system" . + . diff --git a/SBOL3/entity/interaction/interaction.rdf b/SBOL3/entity/interaction/interaction.rdf new file mode 100644 index 0000000..c50cf20 --- /dev/null +++ b/SBOL3/entity/interaction/interaction.rdf @@ -0,0 +1,26 @@ + + + + + + Interaction1 + + + + i13504 system + + + i13504_system + + diff --git a/SBOL3/entity/interaction/interaction.rj b/SBOL3/entity/interaction/interaction.rj new file mode 100644 index 0000000..69283d6 --- /dev/null +++ b/SBOL3/entity/interaction/interaction.rj @@ -0,0 +1,57 @@ +{ + "https://sbolstandard.org/examples/i13504_system/Interaction1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Interaction1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000589" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Interaction" + } + ] + } + , + "https://sbolstandard.org/examples/i13504_system" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504_system" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#hasInteraction" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/Interaction1" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "i13504 system" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } +} diff --git a/SBOL3/entity/interaction/interaction.ttl b/SBOL3/entity/interaction/interaction.ttl new file mode 100644 index 0000000..8c127d0 --- /dev/null +++ b/SBOL3/entity/interaction/interaction.ttl @@ -0,0 +1,23 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + + + a sbol:Interaction; + sbol:displayId "Interaction1"; + sbol:type SBO:0000589 . + +:i13504_system a sbol:Component; + sbol:displayId "i13504_system"; + sbol:hasInteraction ; + sbol:hasNamespace ; + sbol:name "i13504 system"; + sbol:role SO:0000704; + sbol:type SBO:0000251 . diff --git a/SBOL3/entity/interaction/interaction_ordered.nt b/SBOL3/entity/interaction/interaction_ordered.nt new file mode 100644 index 0000000..46a053a --- /dev/null +++ b/SBOL3/entity/interaction/interaction_ordered.nt @@ -0,0 +1,10 @@ + "Interaction1" . + . + . + "i13504_system" . + . + . + "i13504 system" . + . + . + . diff --git a/SBOL3/entity/interface/interface.jsonld b/SBOL3/entity/interface/interface.jsonld index c8cd55c..177fa6f 100644 --- a/SBOL3/entity/interface/interface.jsonld +++ b/SBOL3/entity/interface/interface.jsonld @@ -1,74 +1,42 @@ { "@graph": [ { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/LacI_protein" - }, - "sbol:displayId": "SubComponent1", - "@type": "sbol:SubComponent" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_protein", - "sbol:role": { - "@id": "GO:0003700" - }, - "sbol:description": "LacI protein", - "sbol:name": "LacI", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:type": { - "@id": "SBO:0000252" - }, - "sbol:displayId": "LacI_protein", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/TetR_protein", + "@id": "https://sbolstandard.org/examples/LacI_producer", "sbol:role": { - "@id": "GO:0003700" - }, - "sbol:description": "TetR protein", - "sbol:name": "TetR", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:type": { - "@id": "SBO:0000252" + "@id": "SO:0000704" }, - "sbol:displayId": "TetR_protein", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer", + "@type": "sbol:Component", + "sbol:displayId": "LacI_producer", "sbol:hasFeature": [ { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2" + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2" } ], - "@type": "sbol:Component", - "sbol:description": "LacI producer", - "sbol:hasInterface": { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interface1" + "sbol:type": { + "@id": "SBO:0000251" }, - "sbol:displayId": "LacI_producer", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:role": { - "@id": "SO:0000704" + "sbol:hasInterface": { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interface1" }, - "sbol:type": { - "@id": "SBO:0000251" + "sbol:name": "LacI produce", + "sbol:description": "LacI producer" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/aTC" }, - "sbol:name": "LacI produce" + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" }, { "@id": "https://sbolstandard.org/examples/LacI_producer/Interface1", @@ -89,6 +57,14 @@ "sbol:displayId": "Interface1", "@type": "sbol:Interface" }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LacI_protein" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, { "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2", "sbol:instanceOf": { @@ -98,12 +74,36 @@ "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/aTC" + "@id": "https://sbolstandard.org/examples/TetR_protein", + "sbol:role": { + "@id": "GO:0003700" }, - "sbol:displayId": "SubComponent3", - "@type": "sbol:SubComponent" + "sbol:description": "TetR protein", + "sbol:name": "TetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "TetR_protein", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_protein", + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:description": "LacI protein", + "sbol:name": "LacI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "LacI_protein", + "@type": "sbol:Component" }, { "@id": "https://sbolstandard.org/examples/aTC", diff --git a/SBOL3/entity/interface/interface.jsonld_expanded b/SBOL3/entity/interface/interface.jsonld_expanded index 8e6b44b..9c9073d 100644 --- a/SBOL3/entity/interface/interface.jsonld_expanded +++ b/SBOL3/entity/interface/interface.jsonld_expanded @@ -1,139 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/LacI_producer", - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#description" : [ { - "@value" : "LacI producer" - } ], - "http://sbols.org/v3#hasInterface" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interface1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "LacI_producer" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000704" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "LacI produce" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interface1", - "http://sbols.org/v3#nondirectional" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" - } ], - "http://sbols.org/v3#output" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" - } ], - "http://sbols.org/v3#input" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interface1" - } ], - "@type" : [ "http://sbols.org/v3#Interface" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_protein" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_protein" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/aTC" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent3" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_protein", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/GO:0003700" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "LacI protein" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "LacI" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "LacI_protein" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_protein", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/GO:0003700" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "TetR protein" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "TetR" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "TetR_protein" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/aTC", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/CHEBI:35224" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "aTC" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "aTC" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000247" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "aTC" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/LacI_producer","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#displayId":[{"@value":"LacI_producer"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent3"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent2"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#hasInterface":[{"@id":"https://sbolstandard.org/examples/LacI_producer/Interface1"}],"http://sbols.org/v3#name":[{"@value":"LacI produce"}],"http://sbols.org/v3#description":[{"@value":"LacI producer"}]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent3","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/aTC"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interface1","http://sbols.org/v3#nondirectional":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent3"}],"http://sbols.org/v3#output":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent1"}],"http://sbols.org/v3#input":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent2"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"Interface1"}],"@type":["http://sbols.org/v3#Interface"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/LacI_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/TetR_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/TetR_protein","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#description":[{"@value":"TetR protein"}],"http://sbols.org/v3#name":[{"@value":"TetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#displayId":[{"@value":"TetR_protein"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/LacI_protein","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#description":[{"@value":"LacI protein"}],"http://sbols.org/v3#name":[{"@value":"LacI"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#displayId":[{"@value":"LacI_protein"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/aTC","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/CHEBI:35224"}],"http://sbols.org/v3#description":[{"@value":"aTC"}],"http://sbols.org/v3#name":[{"@value":"aTC"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000247"}],"http://sbols.org/v3#displayId":[{"@value":"aTC"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/interface/interface.nt b/SBOL3/entity/interface/interface.nt index b571a4a..d88ec7e 100644 --- a/SBOL3/entity/interface/interface.nt +++ b/SBOL3/entity/interface/interface.nt @@ -1,30 +1,14 @@ - . - "SubComponent1" . - . - . - "TetR protein" . - "TetR" . - . - . - "TetR_protein" . - . - . + . . - "LacI producer" . - . "LacI_producer" . - . - . . - . . + . + . "LacI produce" . - . - . - . - . - "Interface1" . - . + . + . + "LacI producer" . . "SubComponent2" . . @@ -35,6 +19,16 @@ . "LacI_protein" . . + . + "SubComponent1" . + . + . + "TetR protein" . + "TetR" . + . + . + "TetR_protein" . + . . "SubComponent3" . . @@ -45,3 +39,9 @@ . "aTC" . . + . + . + . + . + "Interface1" . + . diff --git a/SBOL3/entity/interface/interface.rdf b/SBOL3/entity/interface/interface.rdf index 32289ba..4dbbfb5 100644 --- a/SBOL3/entity/interface/interface.rdf +++ b/SBOL3/entity/interface/interface.rdf @@ -10,14 +10,6 @@ xmlns="https://sbolstandard.org/examples/" xmlns:om="http://www.ontology-of-units-of-measure.org/resource/om-2/" xml:base="https://sbolstandard.org/examples/"> - - - aTC - aTC - - - aTC - TetR protein @@ -26,25 +18,36 @@ TetR_protein + + + aTC + aTC + + + aTC + + + LacI_producer - - - - - SubComponent1 + + + SubComponent3 - LacI producer + + - - - - SubComponent3 + + + + + + + SubComponent1 - - + @@ -55,13 +58,10 @@ Interface1 - LacI_producer - - - - - LacI produce + + + LacI producer diff --git a/SBOL3/entity/interface/interface.rj b/SBOL3/entity/interface/interface.rj index 6974fde..d159a1b 100644 --- a/SBOL3/entity/interface/interface.rj +++ b/SBOL3/entity/interface/interface.rj @@ -1,106 +1,110 @@ { - "https://sbolstandard.org/examples/aTC" : { + "https://sbolstandard.org/examples/LacI_producer/SubComponent2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "aTC" + "value" : "SubComponent2" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/CHEBI:35224" + "value" : "https://sbolstandard.org/examples/TetR_protein" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" - } - ] , - "http://sbols.org/v3#hasNamespace" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "http://sbols.org/v3#SubComponent" } - ] , - "http://sbols.org/v3#name" : [ { + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent1" : { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "aTC" + "value" : "SubComponent1" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "aTC" + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_protein" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000247" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/LacI_producer/Interface1" : { + "https://sbolstandard.org/examples/TetR_protein" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interface1" + "value" : "TetR_protein" } ] , - "http://sbols.org/v3#nondirectional" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + "value" : "https://identifiers.org/GO:0003700" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Interface" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "TetR protein" } ] , - "http://sbols.org/v3#output" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#input" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + "value" : "https://identifiers.org/SBO:0000252" } - , { + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "TetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/LacI_producer/SubComponent1" : { + "https://sbolstandard.org/examples/LacI_producer/SubComponent3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent1" + "value" : "SubComponent3" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/aTC" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_protein" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/TetR_protein" : { + "https://sbolstandard.org/examples/aTC" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "TetR_protein" + "value" : "aTC" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/GO:0003700" + "value" : "https://identifiers.org/CHEBI:35224" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "aTC" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -108,19 +112,19 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "TetR" + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000247" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "TetR protein" + "value" : "aTC" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Component" } ] } @@ -131,19 +135,22 @@ "value" : "LacI_producer" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#hasFeature" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000704" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2" } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + , { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" } ] , - "http://sbols.org/v3#hasInterface" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interface1" + "value" : "https://identifiers.org/SO:0000704" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -151,17 +158,19 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#hasFeature" : [ { + "http://sbols.org/v3#hasInterface" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + "value" : "https://sbolstandard.org/examples/LacI_producer/Interface1" } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "LacI producer" } - , { + ] , + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2" + "value" : "https://identifiers.org/SBO:0000251" } ] , "http://sbols.org/v3#name" : [ { @@ -169,88 +178,79 @@ "value" : "LacI produce" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "LacI producer" - } - ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/LacI_protein" : { + "https://sbolstandard.org/examples/LacI_producer/Interface1" : { + "http://sbols.org/v3#nondirectional" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "LacI_protein" + "value" : "Interface1" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#output" : [ { "type" : "uri" , - "value" : "https://identifiers.org/GO:0003700" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#input" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "LacI" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "LacI protein" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Interface" } ] } , - "https://sbolstandard.org/examples/LacI_producer/SubComponent3" : { + "https://sbolstandard.org/examples/LacI_protein" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent3" + "value" : "LacI_protein" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/GO:0003700" } ] , - "http://sbols.org/v3#instanceOf" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/aTC" - } - ] - } - , - "https://sbolstandard.org/examples/LacI_producer/SubComponent2" : { - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "LacI protein" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_protein" + "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "LacI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } diff --git a/SBOL3/entity/interface/interface.ttl b/SBOL3/entity/interface/interface.ttl index 7abac2c..208ee39 100644 --- a/SBOL3/entity/interface/interface.ttl +++ b/SBOL3/entity/interface/interface.ttl @@ -1,66 +1,66 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :LacI_protein . - -:TetR_protein a sbol:Component ; - sbol:description "TetR protein" ; - sbol:displayId "TetR_protein" ; - sbol:hasNamespace ; - sbol:name "TetR" ; - sbol:role GO:0003700 ; - sbol:type SBO:0000252 . - -:LacI_producer a sbol:Component ; - sbol:description "LacI producer" ; - sbol:displayId "LacI_producer" ; - sbol:hasFeature , , ; - sbol:hasInterface ; - sbol:hasNamespace ; - sbol:name "LacI produce" ; - sbol:role SO:0000704 ; +:LacI_producer a sbol:Component; + sbol:description "LacI producer"; + sbol:displayId "LacI_producer"; + sbol:hasFeature , , ; + sbol:hasInterface ; + sbol:hasNamespace ; + sbol:name "LacI produce"; + sbol:role SO:0000704; sbol:type SBO:0000251 . - - a sbol:Interface ; - sbol:displayId "Interface1" ; - sbol:input , ; - sbol:nondirectional ; - sbol:output . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; + a sbol:SubComponent; + sbol:displayId "SubComponent2"; sbol:instanceOf :TetR_protein . -:LacI_protein a sbol:Component ; - sbol:description "LacI protein" ; - sbol:displayId "LacI_protein" ; - sbol:hasNamespace ; - sbol:name "LacI" ; - sbol:role GO:0003700 ; +:LacI_protein a sbol:Component; + sbol:description "LacI protein"; + sbol:displayId "LacI_protein"; + sbol:hasNamespace ; + sbol:name "LacI"; + sbol:role GO:0003700; + sbol:type SBO:0000252 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :LacI_protein . + +:TetR_protein a sbol:Component; + sbol:description "TetR protein"; + sbol:displayId "TetR_protein"; + sbol:hasNamespace ; + sbol:name "TetR"; + sbol:role GO:0003700; sbol:type SBO:0000252 . - a sbol:SubComponent ; - sbol:displayId "SubComponent3" ; + a sbol:SubComponent; + sbol:displayId "SubComponent3"; sbol:instanceOf :aTC . -:aTC a sbol:Component ; - sbol:description "aTC" ; - sbol:displayId "aTC" ; - sbol:hasNamespace ; - sbol:name "aTC" ; - sbol:role CHEBI:35224 ; +:aTC a sbol:Component; + sbol:description "aTC"; + sbol:displayId "aTC"; + sbol:hasNamespace ; + sbol:name "aTC"; + sbol:role CHEBI:35224; sbol:type SBO:0000247 . + + + a sbol:Interface; + sbol:displayId "Interface1"; + sbol:input , ; + sbol:nondirectional ; + sbol:output . diff --git a/SBOL3/entity/localsubcomponent/localsubcomponent.jsonld b/SBOL3/entity/localsubcomponent/localsubcomponent.jsonld new file mode 100644 index 0000000..2128641 --- /dev/null +++ b/SBOL3/entity/localsubcomponent/localsubcomponent.jsonld @@ -0,0 +1,43 @@ +{ + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/i13504_system/LocalSubComponent1", + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "LocalSubComponent1", + "@type": "sbol:LocalSubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system", + "sbol:hasFeature": { + "@id": "https://sbolstandard.org/examples/i13504_system/LocalSubComponent1" + }, + "sbol:role": { + "@id": "SO:0000804" + }, + "sbol:name": "i13504 system", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "i13504_system", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/localsubcomponent/localsubcomponent.jsonld_expanded b/SBOL3/entity/localsubcomponent/localsubcomponent.jsonld_expanded new file mode 100644 index 0000000..3e3659a --- /dev/null +++ b/SBOL3/entity/localsubcomponent/localsubcomponent.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://sbolstandard.org/examples/i13504_system/LocalSubComponent1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"LocalSubComponent1"}],"@type":["http://sbols.org/v3#LocalSubComponent"]},{"@id":"https://sbolstandard.org/examples/i13504_system","http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/i13504_system/LocalSubComponent1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000804"}],"http://sbols.org/v3#name":[{"@value":"i13504 system"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"i13504_system"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/localsubcomponent/localsubcomponent.nt b/SBOL3/entity/localsubcomponent/localsubcomponent.nt new file mode 100644 index 0000000..5c3e481 --- /dev/null +++ b/SBOL3/entity/localsubcomponent/localsubcomponent.nt @@ -0,0 +1,11 @@ + . + . + "LocalSubComponent1" . + . + . + . + "i13504 system" . + . + . + "i13504_system" . + . diff --git a/SBOL3/entity/localsubcomponent/localsubcomponent.rdf b/SBOL3/entity/localsubcomponent/localsubcomponent.rdf new file mode 100644 index 0000000..0bc4d26 --- /dev/null +++ b/SBOL3/entity/localsubcomponent/localsubcomponent.rdf @@ -0,0 +1,27 @@ + + + + + + + LocalSubComponent1 + + + + i13504 system + + + i13504_system + + diff --git a/SBOL3/entity/localsubcomponent/localsubcomponent.rj b/SBOL3/entity/localsubcomponent/localsubcomponent.rj new file mode 100644 index 0000000..49ac22c --- /dev/null +++ b/SBOL3/entity/localsubcomponent/localsubcomponent.rj @@ -0,0 +1,62 @@ +{ + "https://sbolstandard.org/examples/i13504_system/LocalSubComponent1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "LocalSubComponent1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000316" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#LocalSubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/i13504_system" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/LocalSubComponent1" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504_system" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000804" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "i13504 system" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } +} diff --git a/SBOL3/entity/localsubcomponent/localsubcomponent.ttl b/SBOL3/entity/localsubcomponent/localsubcomponent.ttl new file mode 100644 index 0000000..e7beef1 --- /dev/null +++ b/SBOL3/entity/localsubcomponent/localsubcomponent.ttl @@ -0,0 +1,24 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + + + a sbol:LocalSubComponent; + sbol:displayId "LocalSubComponent1"; + sbol:role SO:0000316; + sbol:type SBO:0000251 . + +:i13504_system a sbol:Component; + sbol:displayId "i13504_system"; + sbol:hasFeature ; + sbol:hasNamespace ; + sbol:name "i13504 system"; + sbol:role SO:0000804; + sbol:type SBO:0000251 . diff --git a/SBOL3/entity/localsubcomponent/localsubcomponent_ordered.nt b/SBOL3/entity/localsubcomponent/localsubcomponent_ordered.nt new file mode 100644 index 0000000..d3d3381 --- /dev/null +++ b/SBOL3/entity/localsubcomponent/localsubcomponent_ordered.nt @@ -0,0 +1,11 @@ + "LocalSubComponent1" . + . + . + . + "i13504_system" . + . + . + "i13504 system" . + . + . + . diff --git a/SBOL3/entity/model/model.jsonld_expanded b/SBOL3/entity/model/model.jsonld_expanded index ca1d5ea..18c2adf 100644 --- a/SBOL3/entity/model/model.jsonld_expanded +++ b/SBOL3/entity/model/model.jsonld_expanded @@ -1,40 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/model1", - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org" - } ], - "http://sbols.org/v3#framework" : [ { - "@id" : "https://identifiers.org/SBO:0000062" - } ], - "http://sbols.org/v3#source" : [ { - "@id" : "http://virtualparts.org" - } ], - "http://sbols.org/v3#language" : [ { - "@id" : "https://identifiers.org/edam:format_2585" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "model1" - } ], - "@type" : [ "http://sbols.org/v3#Model" ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch", - "http://sbols.org/v3#hasModel" : [ { - "@id" : "https://sbolstandard.org/examples/model1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Toggle Switch genetic circuit" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "Toggle Switch" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "toggle_switch" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/toggle_switch","http://sbols.org/v3#hasModel":[{"@id":"https://sbolstandard.org/examples/model1"}],"http://sbols.org/v3#description":[{"@value":"Toggle Switch genetic circuit"}],"http://sbols.org/v3#name":[{"@value":"Toggle Switch"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#displayId":[{"@value":"toggle_switch"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/model1","http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org"}],"http://sbols.org/v3#framework":[{"@id":"https://identifiers.org/SBO:0000062"}],"http://sbols.org/v3#source":[{"@id":"http://virtualparts.org"}],"http://sbols.org/v3#language":[{"@id":"https://identifiers.org/edam:format_2585"}],"http://sbols.org/v3#displayId":[{"@value":"model1"}],"@type":["http://sbols.org/v3#Model"]}]} \ No newline at end of file diff --git a/SBOL3/entity/model/model.rj b/SBOL3/entity/model/model.rj index e455ae2..c91aacd 100644 --- a/SBOL3/entity/model/model.rj +++ b/SBOL3/entity/model/model.rj @@ -1,71 +1,71 @@ { - "https://sbolstandard.org/examples/toggle_switch" : { + "https://sbolstandard.org/examples/model1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "toggle_switch" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "model1" } ] , "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://sbolstandard.org" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "Toggle Switch" + "http://sbols.org/v3#source" : [ { + "type" : "uri" , + "value" : "http://virtualparts.org" } ] , - "http://sbols.org/v3#hasModel" : [ { + "http://sbols.org/v3#language" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/model1" + "value" : "https://identifiers.org/edam:format_2585" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Toggle Switch genetic circuit" + "http://sbols.org/v3#framework" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000062" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "http://sbols.org/v3#Model" } ] } , - "https://sbolstandard.org/examples/model1" : { + "https://sbolstandard.org/examples/toggle_switch" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "model1" + "value" : "toggle_switch" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Model" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Toggle Switch genetic circuit" } ] , "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#framework" : [ { + "http://sbols.org/v3#hasModel" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000062" + "value" : "https://sbolstandard.org/examples/model1" } ] , - "http://sbols.org/v3#source" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://virtualparts.org" + "value" : "https://identifiers.org/SBO:0000241" } ] , - "http://sbols.org/v3#language" : [ { + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Toggle Switch" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/edam:format_2585" + "value" : "http://sbols.org/v3#Component" } ] } diff --git a/SBOL3/entity/model/model.ttl b/SBOL3/entity/model/model.ttl index c8c75db..b43e0a2 100644 --- a/SBOL3/entity/model/model.ttl +++ b/SBOL3/entity/model/model.ttl @@ -1,25 +1,25 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: -:toggle_switch a sbol:Component ; - sbol:description "Toggle Switch genetic circuit" ; - sbol:displayId "toggle_switch" ; - sbol:hasModel :model1 ; - sbol:hasNamespace ; - sbol:name "Toggle Switch" ; +:toggle_switch a sbol:Component; + sbol:description "Toggle Switch genetic circuit"; + sbol:displayId "toggle_switch"; + sbol:hasModel :model1; + sbol:hasNamespace ; + sbol:name "Toggle Switch"; sbol:type SBO:0000241 . -:model1 a sbol:Model ; - sbol:displayId "model1" ; - sbol:framework SBO:0000062 ; - sbol:hasNamespace ; - sbol:language EDAM:format_2585 ; +:model1 a sbol:Model; + sbol:displayId "model1"; + sbol:framework SBO:0000062; + sbol:hasNamespace ; + sbol:language EDAM:format_2585; sbol:source . diff --git a/SBOL3/entity/participation/participation.jsonld b/SBOL3/entity/participation/participation.jsonld new file mode 100644 index 0000000..00c7a80 --- /dev/null +++ b/SBOL3/entity/participation/participation.jsonld @@ -0,0 +1,285 @@ +{ + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/E0040", + "sbol:hasFeature": { + "@id": "https://sbolstandard.org/examples/E0040/SequenceFeature1" + }, + "sbol:hasSequence": { + "@id": "https://sbolstandard.org/examples/E0040_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:description": "gfp coding sequence", + "sbol:name": "gfp", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "E0040", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/E0040/SequenceFeature1", + "sbol:hasLocation": { + "@id": "https://sbolstandard.org/examples/E0040/SequenceFeature1/EntireSequence1" + }, + "sbol:displayId": "SequenceFeature1", + "@type": "sbol:SequenceFeature" + }, + { + "@id": "https://sbolstandard.org/examples/E0040_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa", + "sbol:description": "E0040 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "E0040_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://sbolstandard.org/examples/gfp_start", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "gfp_start", + "@type": "sbol:Sequence" + }, + { + "@id": "https://sbolstandard.org/examples/i13504/SubComponent1", + "sbol:hasLocation": { + "@id": "https://sbolstandard.org/examples/i13504/SubComponent1/Range1" + }, + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/E0040" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/i13504/SubComponent1/Range1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:end": "720", + "sbol:start": "1", + "sbol:hasSequence": { + "@id": "https://sbolstandard.org/examples/i13504_Sequence1" + }, + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/GFP_protein" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/GFP_protein", + "sbol:description": "GFP", + "sbol:name": "GFP", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "GFP_protein", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/E0040/SequenceFeature1/EntireSequence1", + "sbol:hasSequence": { + "@id": "https://sbolstandard.org/examples/gfp_start" + }, + "sbol:displayId": "EntireSequence1", + "@type": "sbol:EntireSequence" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction2", + "sbol:hasParticipation": { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction2/Participation1" + }, + "sbol:type": { + "@id": "SBO:0000169" + }, + "sbol:displayId": "Interaction2", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction2/Participation1", + "sbol:higherOrderParticipant": { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction1" + }, + "sbol:role": { + "@id": "SBO:0000020" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction1/Participation1", + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/i13504_system/ComponentReference1" + }, + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system/ComponentReference1", + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/i13504_system/SubComponent1" + }, + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/i13504/SubComponent1" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_Sequence1", + "sbol:elements": "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:description": "i13504 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "i13504_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://sbolstandard.org/examples/TetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:displayId": "TetR", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system", + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/i13504_system/ComponentReference1" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system/SubComponent2" + } + ], + "sbol:role": [ + { + "@id": "SO:0000704" + }, + { + "@id": "SBO:0000289" + } + ], + "sbol:hasInteraction": [ + { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction1" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction2" + } + ], + "@type": "sbol:Component", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:name": "i13504 system", + "sbol:displayId": "i13504_system", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + } + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/i13504" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction1", + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction1/Participation2" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction1/Participation1" + } + ], + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/i13504_system/Interaction1/Participation2", + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/i13504_system/SubComponent2" + }, + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/i13504", + "sbol:hasSequence": { + "@id": "https://sbolstandard.org/examples/i13504_Sequence1" + }, + "sbol:hasFeature": { + "@id": "https://sbolstandard.org/examples/i13504/SubComponent1" + }, + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "i13504", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/participation/participation.jsonld_expanded b/SBOL3/entity/participation/participation.jsonld_expanded new file mode 100644 index 0000000..0ffd6d7 --- /dev/null +++ b/SBOL3/entity/participation/participation.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://sbolstandard.org/examples/E0040","http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/E0040/SequenceFeature1"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://sbolstandard.org/examples/E0040_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#description":[{"@value":"gfp coding sequence"}],"http://sbols.org/v3#name":[{"@value":"gfp"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"E0040"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/E0040/SequenceFeature1","http://sbols.org/v3#hasLocation":[{"@id":"https://sbolstandard.org/examples/E0040/SequenceFeature1/EntireSequence1"}],"http://sbols.org/v3#displayId":[{"@value":"SequenceFeature1"}],"@type":["http://sbols.org/v3#SequenceFeature"]},{"@id":"https://sbolstandard.org/examples/E0040_Sequence1","http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa"}],"http://sbols.org/v3#description":[{"@value":"E0040 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"E0040_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://sbolstandard.org/examples/gfp_start","http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"gfp_start"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://sbolstandard.org/examples/i13504/SubComponent1","http://sbols.org/v3#hasLocation":[{"@id":"https://sbolstandard.org/examples/i13504/SubComponent1/Range1"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/E0040"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/i13504/SubComponent1/Range1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#end":[{"@value":"720"}],"http://sbols.org/v3#start":[{"@value":"1"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://sbolstandard.org/examples/i13504_Sequence1"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://sbolstandard.org/examples/i13504_system/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/GFP_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/GFP_protein","http://sbols.org/v3#description":[{"@value":"GFP"}],"http://sbols.org/v3#name":[{"@value":"GFP"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#displayId":[{"@value":"GFP_protein"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/E0040/SequenceFeature1/EntireSequence1","http://sbols.org/v3#hasSequence":[{"@id":"https://sbolstandard.org/examples/gfp_start"}],"http://sbols.org/v3#displayId":[{"@value":"EntireSequence1"}],"@type":["http://sbols.org/v3#EntireSequence"]},{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction2","http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction2/Participation1"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000169"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction2"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction2/Participation1","http://sbols.org/v3#higherOrderParticipant":[{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000020"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction1/Participation1","http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/i13504_system/ComponentReference1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000645"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/i13504_system/ComponentReference1","http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/i13504_system/SubComponent1"}],"http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/i13504/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference1"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/i13504_Sequence1","http://sbols.org/v3#elements":[{"@value":"atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#description":[{"@value":"i13504 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"i13504_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://sbolstandard.org/examples/TetR","http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#displayId":[{"@value":"TetR"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/i13504_system","http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/i13504_system/ComponentReference1"},{"@id":"https://sbolstandard.org/examples/i13504_system/SubComponent1"},{"@id":"https://sbolstandard.org/examples/i13504_system/SubComponent2"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"},{"@id":"https://identifiers.org/SBO:0000289"}],"http://sbols.org/v3#hasInteraction":[{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction1"},{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction2"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#name":[{"@value":"i13504 system"}],"http://sbols.org/v3#displayId":[{"@value":"i13504_system"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}]},{"@id":"https://sbolstandard.org/examples/i13504_system/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/i13504"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction1","http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction1/Participation2"},{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction1/Participation1"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction1"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/i13504_system/Interaction1/Participation2","http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/i13504_system/SubComponent2"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/i13504","http://sbols.org/v3#hasSequence":[{"@id":"https://sbolstandard.org/examples/i13504_Sequence1"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/i13504/SubComponent1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"i13504"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/participation/participation.nt b/SBOL3/entity/participation/participation.nt new file mode 100644 index 0000000..3f4e9ec --- /dev/null +++ b/SBOL3/entity/participation/participation.nt @@ -0,0 +1,103 @@ + . + . + . + "gfp coding sequence" . + "gfp" . + . + . + "E0040" . + . + . + "gfp_start" . + . + . + . + . + "SubComponent1" . + . + . + "SubComponent2" . + . + "GFP" . + "GFP" . + . + . + "GFP_protein" . + . + . + "EntireSequence1" . + . + . + . + "Interaction2" . + . + . + . + "Participation1" . + . + . + "720" . + "1" . + . + "Range1" . + . + . + "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" . + "E0040 sequence" . + "Sequence1" . + . + "E0040_Sequence1" . + . + . + . + "TetR" . + . + "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" . + . + "i13504 sequence" . + "Sequence1" . + . + "i13504_Sequence1" . + . + . + . + . + . + . + . + . + "i13504 system" . + "i13504_system" . + . + . + . + . + "SequenceFeature1" . + . + . + . + "Participation2" . + . + . + "SubComponent1" . + . + . + . + . + . + . + "i13504" . + . + . + . + "Participation1" . + . + . + . + "ComponentReference1" . + . + . + . + . + "Interaction1" . + . diff --git a/SBOL3/entity/participation/participation.rdf b/SBOL3/entity/participation/participation.rdf new file mode 100644 index 0000000..4a2ed6f --- /dev/null +++ b/SBOL3/entity/participation/participation.rdf @@ -0,0 +1,160 @@ + + + + + TetR + + + + + + + + + + EntireSequence1 + + + SequenceFeature1 + + + + + + + gfp coding sequence + gfp + + + E0040 + + + + + + + + + + SubComponent1 + + + + + + + + 720 + 1 + + + + Range1 + + + + + SubComponent1 + + + ComponentReference1 + + + + + + + + + + + + + + SubComponent2 + + + + Participation2 + + + + + + + Participation1 + + + + Interaction1 + + + + + i13504 system + i13504_system + + + + + + + Participation1 + + + + Interaction2 + + + + + + + GFP + GFP + + + GFP_protein + + + + + + + + + + i13504 + + + atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa + + i13504 sequence + Sequence1 + + i13504_Sequence1 + + + + atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa + E0040 sequence + Sequence1 + + E0040_Sequence1 + + + + gfp_start + + diff --git a/SBOL3/entity/participation/participation.rj b/SBOL3/entity/participation/participation.rj new file mode 100644 index 0000000..0d69254 --- /dev/null +++ b/SBOL3/entity/participation/participation.rj @@ -0,0 +1,571 @@ +{ + "https://sbolstandard.org/examples/i13504/SubComponent1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#hasLocation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504/SubComponent1/Range1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/E0040" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/i13504/SubComponent1/Range1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "720" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Range1" + } + ] , + "http://sbols.org/v3#start" : [ { + "type" : "literal" , + "value" : "1" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Range" + } + ] + } + , + "https://sbolstandard.org/examples/E0040" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/E0040/SequenceFeature1" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "E0040" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000316" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "gfp coding sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/E0040_Sequence1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "gfp" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/gfp_start" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "gfp_start" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://sbolstandard.org/examples/GFP_protein" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "GFP_protein" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "GFP" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "GFP" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/i13504_system/ComponentReference1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ComponentReference1" + } + ] , + "http://sbols.org/v3#inChildOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/SubComponent1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#ComponentReference" + } + ] , + "http://sbols.org/v3#refersTo" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504/SubComponent1" + } + ] + } + , + "https://sbolstandard.org/examples/i13504" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504/SubComponent1" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_Sequence1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/i13504_system/Interaction2/Participation1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation1" + } + ] , + "http://sbols.org/v3#higherOrderParticipant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/Interaction1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000020" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/i13504_system/Interaction1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Interaction1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000589" + } + ] , + "http://sbols.org/v3#hasParticipation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/Interaction1/Participation1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/Interaction1/Participation2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Interaction" + } + ] + } + , + "https://sbolstandard.org/examples/i13504_system/Interaction2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Interaction2" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000169" + } + ] , + "http://sbols.org/v3#hasParticipation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/Interaction2/Participation1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Interaction" + } + ] + } + , + "https://sbolstandard.org/examples/TetR" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "TetR" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/i13504_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "i13504 sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://sbolstandard.org/examples/E0040/SequenceFeature1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SequenceFeature1" + } + ] , + "http://sbols.org/v3#hasLocation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/E0040/SequenceFeature1/EntireSequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SequenceFeature" + } + ] + } + , + "https://sbolstandard.org/examples/E0040_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "E0040_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "E0040 sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://sbolstandard.org/examples/i13504_system" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/SubComponent1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/ComponentReference1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/SubComponent2" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504_system" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + , { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000289" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#hasInteraction" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/Interaction1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/Interaction2" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "i13504 system" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/i13504_system/Interaction1/Participation1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000645" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/ComponentReference1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/i13504_system/SubComponent1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/i13504_system/SubComponent2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent2" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/GFP_protein" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/i13504_system/Interaction1/Participation2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation2" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000011" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/i13504_system/SubComponent2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/E0040/SequenceFeature1/EntireSequence1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "EntireSequence1" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/gfp_start" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#EntireSequence" + } + ] + } +} diff --git a/SBOL3/entity/participation/participation.ttl b/SBOL3/entity/participation/participation.ttl new file mode 100644 index 0000000..3b8c951 --- /dev/null +++ b/SBOL3/entity/participation/participation.ttl @@ -0,0 +1,140 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + +:E0040 a sbol:Component; + sbol:description "gfp coding sequence"; + sbol:displayId "E0040"; + sbol:hasFeature ; + sbol:hasNamespace ; + sbol:hasSequence :E0040_Sequence1; + sbol:name "gfp"; + sbol:role SO:0000316; + sbol:type SBO:0000251 . + +:gfp_start a sbol:Sequence; + sbol:displayId "gfp_start"; + sbol:hasNamespace . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:hasLocation ; + sbol:instanceOf :E0040; + sbol:orientation SO:0001030 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :GFP_protein . + +:GFP_protein a sbol:Component; + sbol:description "GFP"; + sbol:displayId "GFP_protein"; + sbol:hasNamespace ; + sbol:name "GFP"; + sbol:type SBO:0000252 . + + + a sbol:EntireSequence; + sbol:displayId "EntireSequence1"; + sbol:hasSequence :gfp_start . + + + a sbol:Interaction; + sbol:displayId "Interaction2"; + sbol:hasParticipation ; + sbol:type SBO:0000169 . + + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000645 . + + + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "720"; + sbol:hasSequence :i13504_Sequence1; + sbol:orientation SO:0001030; + sbol:start "1" . + +:E0040_Sequence1 a sbol:Sequence; + sbol:description "E0040 sequence"; + sbol:displayId "E0040_Sequence1"; + sbol:elements "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace ; + sbol:name "Sequence1" . + +:TetR a sbol:Component; + sbol:displayId "TetR"; + sbol:hasNamespace ; + sbol:type SBO:0000252 . + +:i13504_Sequence1 a sbol:Sequence; + sbol:description "i13504 sequence"; + sbol:displayId "i13504_Sequence1"; + sbol:elements "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace ; + sbol:name "Sequence1" . + +:i13504_system a sbol:Component; + sbol:displayId "i13504_system"; + sbol:hasFeature , , ; + sbol:hasInteraction , ; + sbol:hasNamespace ; + sbol:name "i13504 system"; + sbol:role SO:0000704 , SBO:0000289; + sbol:type SBO:0000251 . + + + a sbol:SequenceFeature; + sbol:displayId "SequenceFeature1"; + sbol:hasLocation . + + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000011 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :i13504 . + +:i13504 a sbol:Component; + sbol:displayId "i13504"; + sbol:hasFeature ; + sbol:hasNamespace ; + sbol:hasSequence :i13504_Sequence1; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:higherOrderParticipant ; + sbol:role SBO:0000020 . + + + a sbol:ComponentReference; + sbol:displayId "ComponentReference1"; + sbol:inChildOf ; + sbol:refersTo . + + + a sbol:Interaction; + sbol:displayId "Interaction1"; + sbol:hasParticipation , ; + sbol:type SBO:0000589 . diff --git a/SBOL3/entity/participation/participation_ordered.nt b/SBOL3/entity/participation/participation_ordered.nt new file mode 100644 index 0000000..204c447 --- /dev/null +++ b/SBOL3/entity/participation/participation_ordered.nt @@ -0,0 +1,103 @@ + "EntireSequence1" . + . + . + "SequenceFeature1" . + . + . + "gfp coding sequence" . + "E0040" . + . + . + . + "gfp" . + . + . + . + "E0040 sequence" . + "E0040_Sequence1" . + "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" . + . + . + "Sequence1" . + . + "GFP" . + "GFP_protein" . + . + "GFP" . + . + . + "TetR" . + . + . + . + "gfp_start" . + . + . + "Range1" . + "720" . + . + . + "1" . + . + "SubComponent1" . + . + . + . + . + "i13504" . + . + . + . + . + . + . + "i13504 sequence" . + "i13504_Sequence1" . + "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" . + . + . + "Sequence1" . + . + "ComponentReference1" . + . + . + . + "Participation1" . + . + . + . + "Participation2" . + . + . + . + "Interaction1" . + . + . + . + . + "Participation1" . + . + . + . + "Interaction2" . + . + . + . + "SubComponent1" . + . + . + "SubComponent2" . + . + . + "i13504_system" . + . + . + . + . + . + . + "i13504 system" . + . + . + . + . diff --git a/SBOL3/entity/range/range.jsonld b/SBOL3/entity/range/range.jsonld new file mode 100644 index 0000000..25fe987 --- /dev/null +++ b/SBOL3/entity/range/range.jsonld @@ -0,0 +1,109 @@ +{ + "@graph": [ + { + "@id": "https://synbiohub.org/public/igem/i13504", + "sbol:hasFeature": { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1" + }, + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "i13504", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1", + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" + }, + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/B0015" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1", + "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:description": "i13504 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "i13504_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/B0015_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", + "sbol:description": "B0015 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "B0015_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1", + "sbol:order": "1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:end": "80", + "sbol:start": "1", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" + }, + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/B0015", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/B0015_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:description": "B0015 double terminator", + "sbol:name": "terminator", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "B0015", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/range/range.jsonld_expanded b/SBOL3/entity/range/range.jsonld_expanded new file mode 100644 index 0000000..fe219de --- /dev/null +++ b/SBOL3/entity/range/range.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://synbiohub.org/public/igem/i13504","http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent1"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"i13504"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent1","http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent1/Range1"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/B0015"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1","http://sbols.org/v3#elements":[{"@value":"ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#description":[{"@value":"i13504 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"i13504_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/B0015_Sequence1","http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"}],"http://sbols.org/v3#description":[{"@value":"B0015 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"B0015_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent1/Range1","http://sbols.org/v3#order":[{"@value":"1"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#end":[{"@value":"80"}],"http://sbols.org/v3#start":[{"@value":"1"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/B0015","http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/B0015_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#description":[{"@value":"B0015 double terminator"}],"http://sbols.org/v3#name":[{"@value":"terminator"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"B0015"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/range/range.nt b/SBOL3/entity/range/range.nt new file mode 100644 index 0000000..64a1767 --- /dev/null +++ b/SBOL3/entity/range/range.nt @@ -0,0 +1,41 @@ + . + . + . + . + . + "i13504" . + . + . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + "B0015 sequence" . + "Sequence1" . + . + "B0015_Sequence1" . + . + "1" . + . + "80" . + "1" . + . + "Range1" . + . + . + . + . + "SubComponent1" . + . + . + . + "B0015 double terminator" . + "terminator" . + . + . + "B0015" . + . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + . + "i13504 sequence" . + "Sequence1" . + . + "i13504_Sequence1" . + . diff --git a/SBOL3/entity/range/range.rdf b/SBOL3/entity/range/range.rdf new file mode 100644 index 0000000..e6d225f --- /dev/null +++ b/SBOL3/entity/range/range.rdf @@ -0,0 +1,70 @@ + + + + + + + 1 + + 80 + 1 + + + + Range1 + + + + + + + SubComponent1 + + + + + + + + + i13504 + + + + + + + B0015 double terminator + terminator + + + B0015 + + + + ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc + B0015 sequence + Sequence1 + + B0015_Sequence1 + + + ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc + + i13504 sequence + Sequence1 + + i13504_Sequence1 + + diff --git a/SBOL3/entity/range/range.rj b/SBOL3/entity/range/range.rj new file mode 100644 index 0000000..a305922 --- /dev/null +++ b/SBOL3/entity/range/range.rj @@ -0,0 +1,224 @@ +{ + "https://synbiohub.org/public/igem/B0015_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "B0015_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "B0015 sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504/SubComponent1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#hasLocation" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/B0015" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504/SubComponent1" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "80" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Range1" + } + ] , + "http://sbols.org/v3#start" : [ { + "type" : "literal" , + "value" : "1" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" + } + ] , + "http://sbols.org/v3#order" : [ { + "type" : "literal" , + "value" : "1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Range" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "i13504 sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://synbiohub.org/public/igem/B0015" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "B0015" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000141" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "B0015 double terminator" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/B0015_Sequence1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "terminator" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } +} diff --git a/SBOL3/entity/range/range.ttl b/SBOL3/entity/range/range.ttl new file mode 100644 index 0000000..eec596c --- /dev/null +++ b/SBOL3/entity/range/range.ttl @@ -0,0 +1,59 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + +:i13504 a sbol:Component; + sbol:displayId "i13504"; + sbol:hasFeature ; + sbol:hasNamespace <../igem>; + sbol:hasSequence :i13504_Sequence1; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + +:B0015_Sequence1 a sbol:Sequence; + sbol:description "B0015 sequence"; + sbol:displayId "B0015_Sequence1"; + sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . + + + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "80"; + sbol:hasSequence :i13504_Sequence1; + sbol:order "1"; + sbol:orientation SO:0001030; + sbol:start "1" . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:hasLocation ; + sbol:instanceOf :B0015; + sbol:orientation SO:0001030 . + +:B0015 a sbol:Component; + sbol:description "B0015 double terminator"; + sbol:displayId "B0015"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :B0015_Sequence1; + sbol:name "terminator"; + sbol:role SO:0000141; + sbol:type SBO:0000251 . + +:i13504_Sequence1 a sbol:Sequence; + sbol:description "i13504 sequence"; + sbol:displayId "i13504_Sequence1"; + sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . diff --git a/SBOL3/entity/range/range_ordered.nt b/SBOL3/entity/range/range_ordered.nt new file mode 100644 index 0000000..5d9d9ac --- /dev/null +++ b/SBOL3/entity/range/range_ordered.nt @@ -0,0 +1,41 @@ + "B0015 double terminator" . + "B0015" . + . + . + "terminator" . + . + . + . + "B0015 sequence" . + "B0015_Sequence1" . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + . + . + "Sequence1" . + . + "Range1" . + "80" . + . + "1" . + . + "1" . + . + "SubComponent1" . + . + . + . + . + "i13504" . + . + . + . + . + . + . + "i13504 sequence" . + "i13504_Sequence1" . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + . + . + "Sequence1" . + . diff --git a/SBOL3/entity/sequencefeature/sequencefeature.jsonld b/SBOL3/entity/sequencefeature/sequencefeature.jsonld new file mode 100644 index 0000000..f0c2780 --- /dev/null +++ b/SBOL3/entity/sequencefeature/sequencefeature.jsonld @@ -0,0 +1,67 @@ +{ + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/E0040/SequenceFeature1/Range1", + "sbol:end": "3", + "sbol:start": "1", + "sbol:hasSequence": { + "@id": "https://sbolstandard.org/examples/E0040_Sequence1" + }, + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://sbolstandard.org/examples/E0040_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa", + "sbol:description": "E0040 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "E0040_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://sbolstandard.org/examples/E0040/SequenceFeature1", + "sbol:hasLocation": { + "@id": "https://sbolstandard.org/examples/E0040/SequenceFeature1/Range1" + }, + "sbol:displayId": "SequenceFeature1", + "@type": "sbol:SequenceFeature" + }, + { + "@id": "https://sbolstandard.org/examples/E0040", + "sbol:hasFeature": { + "@id": "https://sbolstandard.org/examples/E0040/SequenceFeature1" + }, + "sbol:hasSequence": { + "@id": "https://sbolstandard.org/examples/E0040_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:name": "E0040", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "E0040", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/sequencefeature/sequencefeature.jsonld_expanded b/SBOL3/entity/sequencefeature/sequencefeature.jsonld_expanded new file mode 100644 index 0000000..0856854 --- /dev/null +++ b/SBOL3/entity/sequencefeature/sequencefeature.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://sbolstandard.org/examples/E0040/SequenceFeature1/Range1","http://sbols.org/v3#end":[{"@value":"3"}],"http://sbols.org/v3#start":[{"@value":"1"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://sbolstandard.org/examples/E0040_Sequence1"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://sbolstandard.org/examples/E0040_Sequence1","http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa"}],"http://sbols.org/v3#description":[{"@value":"E0040 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"E0040_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://sbolstandard.org/examples/E0040/SequenceFeature1","http://sbols.org/v3#hasLocation":[{"@id":"https://sbolstandard.org/examples/E0040/SequenceFeature1/Range1"}],"http://sbols.org/v3#displayId":[{"@value":"SequenceFeature1"}],"@type":["http://sbols.org/v3#SequenceFeature"]},{"@id":"https://sbolstandard.org/examples/E0040","http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/E0040/SequenceFeature1"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://sbolstandard.org/examples/E0040_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#name":[{"@value":"E0040"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"E0040"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/sequencefeature/sequencefeature.nt b/SBOL3/entity/sequencefeature/sequencefeature.nt new file mode 100644 index 0000000..8bbd6c3 --- /dev/null +++ b/SBOL3/entity/sequencefeature/sequencefeature.nt @@ -0,0 +1,23 @@ + "3" . + "1" . + . + "Range1" . + . + . + "SequenceFeature1" . + . + . + . + . + "E0040" . + . + . + "E0040" . + . + . + "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" . + "E0040 sequence" . + "Sequence1" . + . + "E0040_Sequence1" . + . diff --git a/SBOL3/entity/sequencefeature/sequencefeature.rdf b/SBOL3/entity/sequencefeature/sequencefeature.rdf new file mode 100644 index 0000000..078f7e3 --- /dev/null +++ b/SBOL3/entity/sequencefeature/sequencefeature.rdf @@ -0,0 +1,46 @@ + + + + + + + 3 + 1 + + + + Range1 + + + SequenceFeature1 + + + + + + + E0040 + + + E0040 + + + + atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa + E0040 sequence + Sequence1 + + E0040_Sequence1 + + diff --git a/SBOL3/entity/sequencefeature/sequencefeature.rj b/SBOL3/entity/sequencefeature/sequencefeature.rj new file mode 100644 index 0000000..0d907fd --- /dev/null +++ b/SBOL3/entity/sequencefeature/sequencefeature.rj @@ -0,0 +1,128 @@ +{ + "https://sbolstandard.org/examples/E0040/SequenceFeature1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SequenceFeature1" + } + ] , + "http://sbols.org/v3#hasLocation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/E0040/SequenceFeature1/Range1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SequenceFeature" + } + ] + } + , + "https://sbolstandard.org/examples/E0040_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "E0040_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "E0040 sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://sbolstandard.org/examples/E0040" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/E0040/SequenceFeature1" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "E0040" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000316" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/E0040_Sequence1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "E0040" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/E0040/SequenceFeature1/Range1" : { + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "3" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Range1" + } + ] , + "http://sbols.org/v3#start" : [ { + "type" : "literal" , + "value" : "1" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/E0040_Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Range" + } + ] + } +} diff --git a/SBOL3/entity/sequencefeature/sequencefeature.ttl b/SBOL3/entity/sequencefeature/sequencefeature.ttl new file mode 100644 index 0000000..35966e0 --- /dev/null +++ b/SBOL3/entity/sequencefeature/sequencefeature.ttl @@ -0,0 +1,39 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + + + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "3"; + sbol:hasSequence :E0040_Sequence1; + sbol:start "1" . + + + a sbol:SequenceFeature; + sbol:displayId "SequenceFeature1"; + sbol:hasLocation . + +:E0040 a sbol:Component; + sbol:displayId "E0040"; + sbol:hasFeature ; + sbol:hasNamespace ; + sbol:hasSequence :E0040_Sequence1; + sbol:name "E0040"; + sbol:role SO:0000316; + sbol:type SBO:0000251 . + +:E0040_Sequence1 a sbol:Sequence; + sbol:description "E0040 sequence"; + sbol:displayId "E0040_Sequence1"; + sbol:elements "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace ; + sbol:name "Sequence1" . diff --git a/SBOL3/entity/sequencefeature/sequencefeature_ordered.nt b/SBOL3/entity/sequencefeature/sequencefeature_ordered.nt new file mode 100644 index 0000000..4f91a52 --- /dev/null +++ b/SBOL3/entity/sequencefeature/sequencefeature_ordered.nt @@ -0,0 +1,23 @@ + "Range1" . + "3" . + . + "1" . + . + "SequenceFeature1" . + . + . + "E0040" . + . + . + . + "E0040" . + . + . + . + "E0040 sequence" . + "E0040_Sequence1" . + "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa" . + . + . + "Sequence1" . + . diff --git a/SBOL3/entity/subcomponent/subcomponent.jsonld b/SBOL3/entity/subcomponent/subcomponent.jsonld new file mode 100644 index 0000000..1a572ac --- /dev/null +++ b/SBOL3/entity/subcomponent/subcomponent.jsonld @@ -0,0 +1,108 @@ +{ + "@graph": [ + { + "@id": "https://synbiohub.org/public/igem/i13504", + "sbol:hasFeature": { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1" + }, + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "i13504", + "@type": "sbol:Component" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1", + "sbol:hasLocation": { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" + }, + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://synbiohub.org/public/igem/B0015" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1", + "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:description": "i13504 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "i13504_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/B0015_Sequence1", + "sbol:encoding": { + "@id": "EDAM:format_1207" + }, + "sbol:elements": "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc", + "sbol:description": "B0015 sequence", + "sbol:name": "Sequence1", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:displayId": "B0015_Sequence1", + "@type": "sbol:Sequence" + }, + { + "@id": "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:end": "80", + "sbol:start": "1", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/i13504_Sequence1" + }, + "sbol:displayId": "Range1", + "@type": "sbol:Range" + }, + { + "@id": "https://synbiohub.org/public/igem/B0015", + "sbol:hasSequence": { + "@id": "https://synbiohub.org/public/igem/B0015_Sequence1" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:description": "B0015 double terminator", + "sbol:name": "terminator", + "sbol:hasNamespace": { + "@id": "https://synbiohub.org/public/igem" + }, + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:displayId": "B0015", + "@type": "sbol:Component" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/entity/subcomponent/subcomponent.jsonld_expanded b/SBOL3/entity/subcomponent/subcomponent.jsonld_expanded new file mode 100644 index 0000000..1c50bde --- /dev/null +++ b/SBOL3/entity/subcomponent/subcomponent.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://synbiohub.org/public/igem/i13504","http://sbols.org/v3#hasFeature":[{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent1"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"i13504"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent1","http://sbols.org/v3#hasLocation":[{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent1/Range1"}],"http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://synbiohub.org/public/igem/B0015"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1","http://sbols.org/v3#elements":[{"@value":"ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"}],"http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#description":[{"@value":"i13504 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"i13504_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/B0015_Sequence1","http://sbols.org/v3#encoding":[{"@id":"https://identifiers.org/edam:format_1207"}],"http://sbols.org/v3#elements":[{"@value":"ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"}],"http://sbols.org/v3#description":[{"@value":"B0015 sequence"}],"http://sbols.org/v3#name":[{"@value":"Sequence1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#displayId":[{"@value":"B0015_Sequence1"}],"@type":["http://sbols.org/v3#Sequence"]},{"@id":"https://synbiohub.org/public/igem/i13504/SubComponent1/Range1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#end":[{"@value":"80"}],"http://sbols.org/v3#start":[{"@value":"1"}],"http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/i13504_Sequence1"}],"http://sbols.org/v3#displayId":[{"@value":"Range1"}],"@type":["http://sbols.org/v3#Range"]},{"@id":"https://synbiohub.org/public/igem/B0015","http://sbols.org/v3#hasSequence":[{"@id":"https://synbiohub.org/public/igem/B0015_Sequence1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#description":[{"@value":"B0015 double terminator"}],"http://sbols.org/v3#name":[{"@value":"terminator"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://synbiohub.org/public/igem"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#displayId":[{"@value":"B0015"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/entity/subcomponent/subcomponent.nt b/SBOL3/entity/subcomponent/subcomponent.nt new file mode 100644 index 0000000..4ce17e1 --- /dev/null +++ b/SBOL3/entity/subcomponent/subcomponent.nt @@ -0,0 +1,40 @@ + . + . + . + . + . + "i13504" . + . + . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + "B0015 sequence" . + "Sequence1" . + . + "B0015_Sequence1" . + . + . + "80" . + "1" . + . + "Range1" . + . + . + . + . + "SubComponent1" . + . + . + . + "B0015 double terminator" . + "terminator" . + . + . + "B0015" . + . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + . + "i13504 sequence" . + "Sequence1" . + . + "i13504_Sequence1" . + . diff --git a/SBOL3/entity/subcomponent/subcomponent.rdf b/SBOL3/entity/subcomponent/subcomponent.rdf new file mode 100644 index 0000000..9d5a0eb --- /dev/null +++ b/SBOL3/entity/subcomponent/subcomponent.rdf @@ -0,0 +1,69 @@ + + + + + + + + 80 + 1 + + + + Range1 + + + + + + + SubComponent1 + + + + + + + + + i13504 + + + + + + + B0015 double terminator + terminator + + + B0015 + + + + ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc + B0015 sequence + Sequence1 + + B0015_Sequence1 + + + ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc + + i13504 sequence + Sequence1 + + i13504_Sequence1 + + diff --git a/SBOL3/entity/subcomponent/subcomponent.rj b/SBOL3/entity/subcomponent/subcomponent.rj new file mode 100644 index 0000000..6036b6a --- /dev/null +++ b/SBOL3/entity/subcomponent/subcomponent.rj @@ -0,0 +1,219 @@ +{ + "https://synbiohub.org/public/igem/B0015_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "B0015_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "B0015 sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504/SubComponent1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#hasLocation" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/B0015" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504/SubComponent1" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504/SubComponent1/Range1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#end" : [ { + "type" : "literal" , + "value" : "80" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Range1" + } + ] , + "http://sbols.org/v3#start" : [ { + "type" : "literal" , + "value" : "1" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/i13504_Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Range" + } + ] + } + , + "https://synbiohub.org/public/igem/i13504_Sequence1" : { + "http://sbols.org/v3#encoding" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/edam:format_1207" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "i13504_Sequence1" + } + ] , + "http://sbols.org/v3#elements" : [ { + "type" : "literal" , + "value" : "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "i13504 sequence" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Sequence1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Sequence" + } + ] + } + , + "https://synbiohub.org/public/igem/B0015" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "B0015" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000141" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "B0015 double terminator" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem" + } + ] , + "http://sbols.org/v3#hasSequence" : [ { + "type" : "uri" , + "value" : "https://synbiohub.org/public/igem/B0015_Sequence1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "terminator" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } +} diff --git a/SBOL3/entity/subcomponent/subcomponent.ttl b/SBOL3/entity/subcomponent/subcomponent.ttl new file mode 100644 index 0000000..d6dd140 --- /dev/null +++ b/SBOL3/entity/subcomponent/subcomponent.ttl @@ -0,0 +1,58 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + +:i13504 a sbol:Component; + sbol:displayId "i13504"; + sbol:hasFeature ; + sbol:hasNamespace <../igem>; + sbol:hasSequence :i13504_Sequence1; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + +:B0015_Sequence1 a sbol:Sequence; + sbol:description "B0015 sequence"; + sbol:displayId "B0015_Sequence1"; + sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . + + + a sbol:Range; + sbol:displayId "Range1"; + sbol:end "80"; + sbol:hasSequence :i13504_Sequence1; + sbol:orientation SO:0001030; + sbol:start "1" . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:hasLocation ; + sbol:instanceOf :B0015; + sbol:orientation SO:0001030 . + +:B0015 a sbol:Component; + sbol:description "B0015 double terminator"; + sbol:displayId "B0015"; + sbol:hasNamespace <../igem>; + sbol:hasSequence :B0015_Sequence1; + sbol:name "terminator"; + sbol:role SO:0000141; + sbol:type SBO:0000251 . + +:i13504_Sequence1 a sbol:Sequence; + sbol:description "i13504 sequence"; + sbol:displayId "i13504_Sequence1"; + sbol:elements "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc"; + sbol:encoding EDAM:format_1207; + sbol:hasNamespace <../igem>; + sbol:name "Sequence1" . diff --git a/SBOL3/entity/subcomponent/subcomponent_ordered.nt b/SBOL3/entity/subcomponent/subcomponent_ordered.nt new file mode 100644 index 0000000..9ca2e06 --- /dev/null +++ b/SBOL3/entity/subcomponent/subcomponent_ordered.nt @@ -0,0 +1,40 @@ + "B0015 double terminator" . + "B0015" . + . + . + "terminator" . + . + . + . + "B0015 sequence" . + "B0015_Sequence1" . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + . + . + "Sequence1" . + . + "Range1" . + "80" . + . + . + "1" . + . + "SubComponent1" . + . + . + . + . + "i13504" . + . + . + . + . + . + . + "i13504 sequence" . + "i13504_Sequence1" . + "ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc" . + . + . + "Sequence1" . + . diff --git a/SBOL3/measurement_entity/measurement/measurement.jsonld b/SBOL3/measurement_entity/measurement/measurement.jsonld index e3743b7..d5a20cf 100644 --- a/SBOL3/measurement_entity/measurement/measurement.jsonld +++ b/SBOL3/measurement_entity/measurement/measurement.jsonld @@ -1,44 +1,58 @@ { "@graph": [ { - "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1", - "sbol:type": [ - { - "@id": "SBO:0000197" - }, - { - "@id": "SBO:0000196" - } + "@id": "https://sbolstandard.org/examples/litre", + "@type": [ + "om:SingularUnit", + "sbol:TopLevel" ], - "om:hasUnit": { - "@id": "https://sbolstandard.org/examples/millimolePerLitre" + "sbol:name": "liter", + "om:comment": "The litre is a unit of volume defined as 1.0e-3 cubic metre.", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "om:hasNumericalValue": "0.1", - "@type": [ - "sbol:Identified", - "om:Measure" + "om:hasFactor": "0.001", + "sbol:displayId": "litre", + "om:alternativeLabel": [ + "litre2", + "liter" ], - "sbol:displayId": "measure1" + "om:label": "liter", + "om:longcomment": "This is an example long comment.", + "om:symbol": "l", + "om:alternativeSymbol": [ + "L", + "L2" + ], + "sbol:description": "The litre is a unit of volume defined as 1.0e-3 cubic metre." }, { - "@id": "https://sbolstandard.org/examples/millimolePerLitre", - "om:hasDenominator": { - "@id": "https://sbolstandard.org/examples/litre" - }, - "om:hasNumerator": { - "@id": "https://sbolstandard.org/examples/millimole" + "@id": "https://sbolstandard.org/examples/kelvin", + "sbol:name": "kelvin", + "om:label": "kelvin", + "om:symbol": "kelvin", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "sbol:name": "millimolar", - "om:label": "millimolar", - "om:symbol": "mmol/l", + "@type": [ + "sbol:TopLevel", + "om:SingularUnit" + ], + "sbol:displayId": "kelvin" + }, + { + "@id": "https://sbolstandard.org/examples/mole", + "sbol:name": "mole", + "om:label": "mole", + "om:symbol": "mol", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, "@type": [ "sbol:TopLevel", - "om:UnitDivision" + "om:SingularUnit" ], - "sbol:displayId": "millimolePerLitre" + "sbol:displayId": "mole" }, { "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1", @@ -55,76 +69,86 @@ "@type": "sbol:ExternallyDefined" }, { - "@id": "https://sbolstandard.org/examples/litre", - "sbol:description": "The litre is a unit of volume defined as 1.0e-3 cubic metre.", - "sbol:name": "liter", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "om:alternativeLabel": [ - "litre2", - "liter" + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1", + "sbol:type": [ + { + "@id": "SBO:0000197" + }, + { + "@id": "SBO:0000196" + } ], - "sbol:displayId": "litre", - "om:symbol": "l", - "om:comment": "The litre is a unit of volume defined as 1.0e-3 cubic metre.", - "om:label": "liter", + "om:hasUnit": { + "@id": "https://sbolstandard.org/examples/millimolePerLitre" + }, + "om:hasNumericalValue": "0.1", "@type": [ - "sbol:TopLevel", - "om:SingularUnit" + "sbol:Identified", + "om:Measure" ], - "om:hasFactor": "0.001", - "om:longcomment": "This is an example long comment.", - "om:alternativeSymbol": [ - "L2", - "L" - ] + "sbol:displayId": "measure1" }, { - "@id": "https://sbolstandard.org/examples/cubicMeter", - "om:hasExponent": "3", - "om:hasBase": { - "@id": "https://sbolstandard.org/examples/meter" + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA", + "sbol:hasFeature": { + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" }, - "sbol:name": "cubicMeter", - "om:label": "cubicMeter", - "om:symbol": "m3", + "sbol:description": "M9 Glucose CAA growth media", + "sbol:name": "M9 Glucose CAA", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "@type": [ - "sbol:TopLevel", - "om:UnitExponentiation" - ], - "sbol:displayId": "cubicMeter" + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:displayId": "M9_Glucose_CAA", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/meter", - "sbol:name": "meter", - "om:label": "meter", - "om:symbol": "m", + "@id": "https://sbolstandard.org/examples/millimole", + "om:hasPrefix": { + "@id": "https://sbolstandard.org/examples/milli" + }, + "om:hasUnit": { + "@id": "https://sbolstandard.org/examples/mole" + }, + "sbol:name": "millimole", + "om:label": "millimole", + "om:symbol": "mmol", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, "@type": [ "sbol:TopLevel", - "om:SingularUnit" + "om:PrefixedUnit" ], - "sbol:displayId": "meter" + "sbol:displayId": "millimole" }, { - "@id": "https://sbolstandard.org/examples/kelvin", - "sbol:name": "kelvin", - "om:label": "kelvin", - "om:symbol": "kelvin", + "@id": "https://sbolstandard.org/examples/milli", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, + "om:symbol": "m", + "om:alternativeSymbol": [ + "m2", + "m1" + ], "@type": [ - "sbol:TopLevel", - "om:SingularUnit" + "om:SIPrefix", + "sbol:TopLevel" ], - "sbol:displayId": "kelvin" + "sbol:displayId": "milli", + "om:comment": "Comment for the milli prefix.", + "sbol:name": "milli", + "om:alternativeLabel": [ + "milli2", + "milli1" + ], + "om:longcomment": "This is an example long comment for the milli prefix.", + "om:label": "milli", + "sbol:description": "Comment for the milli prefix.", + "om:hasFactor": "0.001" }, { "@id": "https://sbolstandard.org/examples/kelvinMole", @@ -147,80 +171,56 @@ "sbol:displayId": "kelvinMole" }, { - "@id": "https://sbolstandard.org/examples/mole", - "sbol:name": "mole", - "om:label": "mole", - "om:symbol": "mol", + "@id": "https://sbolstandard.org/examples/millimolePerLitre", + "om:hasDenominator": { + "@id": "https://sbolstandard.org/examples/litre" + }, + "om:hasNumerator": { + "@id": "https://sbolstandard.org/examples/millimole" + }, + "sbol:name": "millimolar", + "om:label": "millimolar", + "om:symbol": "mmol/l", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, "@type": [ "sbol:TopLevel", - "om:SingularUnit" + "om:UnitDivision" ], - "sbol:displayId": "mole" + "sbol:displayId": "millimolePerLitre" }, { - "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA", - "sbol:hasFeature": { - "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" - }, - "sbol:description": "M9 Glucose CAA growth media", - "sbol:name": "M9 Glucose CAA", + "@id": "https://sbolstandard.org/examples/meter", + "sbol:name": "meter", + "om:label": "meter", + "om:symbol": "m", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:type": { - "@id": "SBO:0000241" - }, - "sbol:displayId": "M9_Glucose_CAA", - "@type": "sbol:Component" + "@type": [ + "sbol:TopLevel", + "om:SingularUnit" + ], + "sbol:displayId": "meter" }, { - "@id": "https://sbolstandard.org/examples/millimole", - "om:hasPrefix": { - "@id": "https://sbolstandard.org/examples/milli" - }, - "om:hasUnit": { - "@id": "https://sbolstandard.org/examples/mole" + "@id": "https://sbolstandard.org/examples/cubicMeter", + "om:hasExponent": "3", + "om:hasBase": { + "@id": "https://sbolstandard.org/examples/meter" }, - "sbol:name": "millimole", - "om:label": "millimole", - "om:symbol": "mmol", + "sbol:name": "cubicMeter", + "om:label": "cubicMeter", + "om:symbol": "m3", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, "@type": [ "sbol:TopLevel", - "om:PrefixedUnit" - ], - "sbol:displayId": "millimole" - }, - { - "@id": "https://sbolstandard.org/examples/milli", - "om:alternativeLabel": [ - "milli1", - "milli2" - ], - "@type": [ - "om:SIPrefix", - "sbol:TopLevel" - ], - "om:alternativeSymbol": [ - "m1", - "m2" + "om:UnitExponentiation" ], - "om:longcomment": "This is an example long comment for the milli prefix.", - "om:label": "milli", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "milli", - "sbol:name": "milli", - "sbol:description": "Comment for the milli prefix.", - "om:symbol": "m", - "om:comment": "Comment for the milli prefix.", - "om:hasFactor": "0.001" + "sbol:displayId": "cubicMeter" } ], "@context": { diff --git a/SBOL3/measurement_entity/measurement/measurement.jsonld_expanded b/SBOL3/measurement_entity/measurement/measurement.jsonld_expanded index ff93f5d..e8cbcd8 100644 --- a/SBOL3/measurement_entity/measurement/measurement.jsonld_expanded +++ b/SBOL3/measurement_entity/measurement/measurement.jsonld_expanded @@ -1,284 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA", - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "M9 Glucose CAA growth media" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "M9 Glucose CAA" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "M9_Glucose_CAA" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1", - "http://sbols.org/v3#hasMeasure" : [ { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1" - } ], - "http://sbols.org/v3#definition" : [ { - "@id" : "https://identifiers.org/CHEBI:3312" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000247" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ExternallyDefined1" - } ], - "@type" : [ "http://sbols.org/v3#ExternallyDefined" ] -}, { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000197" - }, { - "@id" : "https://identifiers.org/SBO:0000196" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit" : [ { - "@id" : "https://sbolstandard.org/examples/millimolePerLitre" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumericalValue" : [ { - "@value" : "0.1" - } ], - "@type" : [ "http://sbols.org/v3#Identified", "http://www.ontology-of-units-of-measure.org/resource/om-2/Measure" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "measure1" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/cubicMeter", - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasExponent" : [ { - "@value" : "3" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasBase" : [ { - "@id" : "https://sbolstandard.org/examples/meter" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "cubicMeter" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "cubicMeter" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "m3" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitExponentiation" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "cubicMeter" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/kelvin", - "http://sbols.org/v3#name" : [ { - "@value" : "kelvin" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "kelvin" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "kelvin" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "kelvin" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/kelvinMole", - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasTerm2" : [ { - "@id" : "https://sbolstandard.org/examples/mole" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasTerm1" : [ { - "@id" : "https://sbolstandard.org/examples/kelvin" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "kelvinMole" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "kelvinMole" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "K mol" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitMultiplication" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "kelvinMole" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/litre", - "http://sbols.org/v3#description" : [ { - "@value" : "The litre is a unit of volume defined as 1.0e-3 cubic metre." - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "liter" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeLabel" : [ { - "@value" : "litre2" - }, { - "@value" : "liter" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "litre" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "l" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/comment" : [ { - "@value" : "The litre is a unit of volume defined as 1.0e-3 cubic metre." - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "liter" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor" : [ { - "@value" : "0.001" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/longcomment" : [ { - "@value" : "This is an example long comment." - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeSymbol" : [ { - "@value" : "L2" - }, { - "@value" : "L" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/meter", - "http://sbols.org/v3#name" : [ { - "@value" : "meter" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "meter" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "m" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "meter" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/milli", - "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeLabel" : [ { - "@value" : "milli1" - }, { - "@value" : "milli2" - } ], - "@type" : [ "http://www.ontology-of-units-of-measure.org/resource/om-2/SIPrefix", "http://sbols.org/v3#TopLevel" ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeSymbol" : [ { - "@value" : "m1" - }, { - "@value" : "m2" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/longcomment" : [ { - "@value" : "This is an example long comment for the milli prefix." - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "milli" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "milli" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "milli" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Comment for the milli prefix." - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "m" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/comment" : [ { - "@value" : "Comment for the milli prefix." - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor" : [ { - "@value" : "0.001" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/millimole", - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasPrefix" : [ { - "@id" : "https://sbolstandard.org/examples/milli" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit" : [ { - "@id" : "https://sbolstandard.org/examples/mole" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "millimole" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "millimole" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "mmol" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/PrefixedUnit" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "millimole" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/millimolePerLitre", - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasDenominator" : [ { - "@id" : "https://sbolstandard.org/examples/litre" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumerator" : [ { - "@id" : "https://sbolstandard.org/examples/millimole" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "millimolar" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "millimolar" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "mmol/l" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitDivision" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "millimolePerLitre" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/mole", - "http://sbols.org/v3#name" : [ { - "@value" : "mole" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "mole" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "mol" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "mole" - } ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/litre","@type":["http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit","http://sbols.org/v3#TopLevel"],"http://sbols.org/v3#name":[{"@value":"liter"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/comment":[{"@value":"The litre is a unit of volume defined as 1.0e-3 cubic metre."}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor":[{"@value":"0.001"}],"http://sbols.org/v3#displayId":[{"@value":"litre"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeLabel":[{"@value":"litre2"},{"@value":"liter"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"liter"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/longcomment":[{"@value":"This is an example long comment."}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"l"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeSymbol":[{"@value":"L"},{"@value":"L2"}],"http://sbols.org/v3#description":[{"@value":"The litre is a unit of volume defined as 1.0e-3 cubic metre."}]},{"@id":"https://sbolstandard.org/examples/kelvin","http://sbols.org/v3#name":[{"@value":"kelvin"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"kelvin"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"kelvin"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#TopLevel","http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit"],"http://sbols.org/v3#displayId":[{"@value":"kelvin"}]},{"@id":"https://sbolstandard.org/examples/mole","http://sbols.org/v3#name":[{"@value":"mole"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"mole"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"mol"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#TopLevel","http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit"],"http://sbols.org/v3#displayId":[{"@value":"mole"}]},{"@id":"https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1","http://sbols.org/v3#hasMeasure":[{"@id":"https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1"}],"http://sbols.org/v3#definition":[{"@id":"https://identifiers.org/CHEBI:3312"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000247"}],"http://sbols.org/v3#displayId":[{"@value":"ExternallyDefined1"}],"@type":["http://sbols.org/v3#ExternallyDefined"]},{"@id":"https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000197"},{"@id":"https://identifiers.org/SBO:0000196"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit":[{"@id":"https://sbolstandard.org/examples/millimolePerLitre"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumericalValue":[{"@value":"0.1"}],"@type":["http://sbols.org/v3#Identified","http://www.ontology-of-units-of-measure.org/resource/om-2/Measure"],"http://sbols.org/v3#displayId":[{"@value":"measure1"}]},{"@id":"https://sbolstandard.org/examples/M9_Glucose_CAA","http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1"}],"http://sbols.org/v3#description":[{"@value":"M9 Glucose CAA growth media"}],"http://sbols.org/v3#name":[{"@value":"M9 Glucose CAA"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#displayId":[{"@value":"M9_Glucose_CAA"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/millimole","http://www.ontology-of-units-of-measure.org/resource/om-2/hasPrefix":[{"@id":"https://sbolstandard.org/examples/milli"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit":[{"@id":"https://sbolstandard.org/examples/mole"}],"http://sbols.org/v3#name":[{"@value":"millimole"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"millimole"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"mmol"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#TopLevel","http://www.ontology-of-units-of-measure.org/resource/om-2/PrefixedUnit"],"http://sbols.org/v3#displayId":[{"@value":"millimole"}]},{"@id":"https://sbolstandard.org/examples/milli","http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"m"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeSymbol":[{"@value":"m2"},{"@value":"m1"}],"@type":["http://www.ontology-of-units-of-measure.org/resource/om-2/SIPrefix","http://sbols.org/v3#TopLevel"],"http://sbols.org/v3#displayId":[{"@value":"milli"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/comment":[{"@value":"Comment for the milli prefix."}],"http://sbols.org/v3#name":[{"@value":"milli"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeLabel":[{"@value":"milli2"},{"@value":"milli1"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/longcomment":[{"@value":"This is an example long comment for the milli prefix."}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"milli"}],"http://sbols.org/v3#description":[{"@value":"Comment for the milli prefix."}],"http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor":[{"@value":"0.001"}]},{"@id":"https://sbolstandard.org/examples/kelvinMole","http://www.ontology-of-units-of-measure.org/resource/om-2/hasTerm2":[{"@id":"https://sbolstandard.org/examples/mole"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/hasTerm1":[{"@id":"https://sbolstandard.org/examples/kelvin"}],"http://sbols.org/v3#name":[{"@value":"kelvinMole"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"kelvinMole"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"K mol"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#TopLevel","http://www.ontology-of-units-of-measure.org/resource/om-2/UnitMultiplication"],"http://sbols.org/v3#displayId":[{"@value":"kelvinMole"}]},{"@id":"https://sbolstandard.org/examples/millimolePerLitre","http://www.ontology-of-units-of-measure.org/resource/om-2/hasDenominator":[{"@id":"https://sbolstandard.org/examples/litre"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumerator":[{"@id":"https://sbolstandard.org/examples/millimole"}],"http://sbols.org/v3#name":[{"@value":"millimolar"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"millimolar"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"mmol/l"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#TopLevel","http://www.ontology-of-units-of-measure.org/resource/om-2/UnitDivision"],"http://sbols.org/v3#displayId":[{"@value":"millimolePerLitre"}]},{"@id":"https://sbolstandard.org/examples/meter","http://sbols.org/v3#name":[{"@value":"meter"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"meter"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"m"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#TopLevel","http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit"],"http://sbols.org/v3#displayId":[{"@value":"meter"}]},{"@id":"https://sbolstandard.org/examples/cubicMeter","http://www.ontology-of-units-of-measure.org/resource/om-2/hasExponent":[{"@value":"3"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/hasBase":[{"@id":"https://sbolstandard.org/examples/meter"}],"http://sbols.org/v3#name":[{"@value":"cubicMeter"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"cubicMeter"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"m3"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#TopLevel","http://www.ontology-of-units-of-measure.org/resource/om-2/UnitExponentiation"],"http://sbols.org/v3#displayId":[{"@value":"cubicMeter"}]}]} \ No newline at end of file diff --git a/SBOL3/measurement_entity/measurement/measurement.nt b/SBOL3/measurement_entity/measurement/measurement.nt index a8ceeee..2280e48 100644 --- a/SBOL3/measurement_entity/measurement/measurement.nt +++ b/SBOL3/measurement_entity/measurement/measurement.nt @@ -1,39 +1,18 @@ - . - . - . - "0.1" . - . - "measure1" . - . - . - . - . - "ExternallyDefined1" . - . - "The litre is a unit of volume defined as 1.0e-3 cubic metre." . + . "liter" . + "The litre is a unit of volume defined as 1.0e-3 cubic metre." . . - "litre2" . + "0.001" . "litre" . + "litre2" . "liter" . - "l" . - "The litre is a unit of volume defined as 1.0e-3 cubic metre." . "liter" . - . - "0.001" . - . "This is an example long comment." . - "L2" . + "l" . "L" . - "3" . - . - "cubicMeter" . - "cubicMeter" . - "m3" . - . - . - "cubicMeter" . - . + . + "The litre is a unit of volume defined as 1.0e-3 cubic metre." . + "L2" . "kelvin" . "kelvin" . "kelvin" . @@ -41,6 +20,34 @@ . "kelvin" . . + "mole" . + "mole" . + "mol" . + . + . + "mole" . + . + . + . + . + "ExternallyDefined1" . + . + . + "M9 Glucose CAA growth media" . + "M9 Glucose CAA" . + . + . + "M9_Glucose_CAA" . + . + . + . + "millimole" . + "millimole" . + "mmol" . + . + . + "millimole" . + . . . "kelvinMole" . @@ -50,20 +57,13 @@ . "kelvinMole" . . - . - "M9 Glucose CAA growth media" . - "M9 Glucose CAA" . - . - . - "M9_Glucose_CAA" . - . - "mole" . - "mole" . - "mol" . - . - . - "mole" . - . + . + . + . + "0.1" . + . + "measure1" . + . "meter" . "meter" . "m" . @@ -71,6 +71,30 @@ . "meter" . . + "3" . + . + "cubicMeter" . + "cubicMeter" . + "m3" . + . + . + "cubicMeter" . + . + . + "m" . + "m2" . + . + . + "milli" . + "Comment for the milli prefix." . + "milli" . + "milli2" . + "milli1" . + "This is an example long comment for the milli prefix." . + "milli" . + "Comment for the milli prefix." . + "0.001" . + "m1" . . . "millimolar" . @@ -80,27 +104,3 @@ . "millimolePerLitre" . . - . - . - "millimole" . - "millimole" . - "mmol" . - . - . - "millimole" . - . - "milli1" . - . - "m1" . - "m2" . - "milli2" . - "This is an example long comment for the milli prefix." . - . - "milli" . - . - "milli" . - "milli" . - "Comment for the milli prefix." . - "m" . - "Comment for the milli prefix." . - "0.001" . diff --git a/SBOL3/measurement_entity/measurement/measurement.rdf b/SBOL3/measurement_entity/measurement/measurement.rdf index 3256fc7..f96f800 100644 --- a/SBOL3/measurement_entity/measurement/measurement.rdf +++ b/SBOL3/measurement_entity/measurement/measurement.rdf @@ -11,21 +11,37 @@ xmlns:om="http://www.ontology-of-units-of-measure.org/resource/om-2/" xml:base="https://sbolstandard.org/examples/"> - milli1 - m1 + + m m2 - milli2 - This is an example long comment for the milli prefix. - milli - milli + Comment for the milli prefix. milli + milli2 + milli1 + This is an example long comment for the milli prefix. + milli Comment for the milli prefix. - m - Comment for the milli prefix. 0.001 + m1 + + liter + The litre is a unit of volume defined as 1.0e-3 cubic metre. + + 0.001 + litre + litre2 + liter + liter + This is an example long comment. + l + L + + The litre is a unit of volume defined as 1.0e-3 cubic metre. + L2 + @@ -60,33 +76,23 @@ kelvin - - The litre is a unit of volume defined as 1.0e-3 cubic metre. - liter + + mole + mole + mol - litre2 - litre - liter - l - The litre is a unit of volume defined as 1.0e-3 cubic metre. - liter - 0.001 + mole - This is an example long comment. - L2 - L - - - - - - millimole - millimole - mmol + + + + kelvinMole + kelvinMole + K mol - millimole - + kelvinMole + meter @@ -96,28 +102,6 @@ meter - - - - millimolar - millimolar - mmol/l - - millimolePerLitre - - - - - - - - kelvinMole - kelvinMole - K mol - - kelvinMole - - 3 @@ -128,12 +112,26 @@ cubicMeter - - mole - mole - mol + + + + + + millimolar + millimolar + mmol/l - mole - + millimolePerLitre + + + + + + millimole + millimole + mmol + + millimole + diff --git a/SBOL3/measurement_entity/measurement/measurement.rj b/SBOL3/measurement_entity/measurement/measurement.rj index 29a02b6..066ce7d 100644 --- a/SBOL3/measurement_entity/measurement/measurement.rj +++ b/SBOL3/measurement_entity/measurement/measurement.rj @@ -1,55 +1,56 @@ { - "https://sbolstandard.org/examples/kelvin" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "kelvin" + "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" : { + "http://sbols.org/v3#definition" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/CHEBI:3312" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "kelvin" + "value" : "ExternallyDefined1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" + "value" : "https://identifiers.org/SBO:0000247" } - , { + ] , + "http://sbols.org/v3#hasMeasure" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "value" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "http://sbols.org/v3#ExternallyDefined" } - ] , - "http://sbols.org/v3#name" : [ { + ] + } + , + "https://sbolstandard.org/examples/kelvin" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { "type" : "literal" , "value" : "kelvin" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { "type" : "literal" , "value" : "kelvin" } - ] - } - , - "https://sbolstandard.org/examples/litre" : { + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "litre" + "value" : "kelvin" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor" : [ { - "type" : "literal" , - "value" : "0.001" + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "liter" + "value" : "kelvin" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { @@ -59,11 +60,24 @@ , { "type" : "uri" , "value" : "http://sbols.org/v3#TopLevel" + } + ] + } + , + "https://sbolstandard.org/examples/mole" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "type" : "literal" , + "value" : "mol" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/comment" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { "type" : "literal" , - "value" : "The litre is a unit of volume defined as 1.0e-3 cubic metre." + "value" : "mole" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "mole" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -71,69 +85,83 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeLabel" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "liter" + "value" : "mole" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" } , { - "type" : "literal" , - "value" : "litre2" + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "liter" + ] + } + , + "https://sbolstandard.org/examples/kelvinMole" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasTerm1" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/kelvin" } ] , "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { "type" : "literal" , - "value" : "l" + "value" : "K mol" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "The litre is a unit of volume defined as 1.0e-3 cubic metre." + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasTerm2" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/mole" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeSymbol" : [ { - "type" : "literal" , - "value" : "L" - } - , { + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { "type" : "literal" , - "value" : "L2" + "value" : "kelvinMole" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/longcomment" : [ { - "type" : "literal" , - "value" : "This is an example long comment." - } - ] - } - , - "https://sbolstandard.org/examples/millimole" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "millimole" + "value" : "kelvinMole" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "millimole" + "value" : "kelvinMole" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/PrefixedUnit" + "value" : "http://sbols.org/v3#TopLevel" } , { "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitMultiplication" + } + ] + } + , + "https://sbolstandard.org/examples/meter" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "type" : "literal" , + "value" : "m" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/mole" + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "type" : "literal" , + "value" : "meter" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "meter" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -143,34 +171,29 @@ ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "millimole" + "value" : "meter" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "type" : "literal" , - "value" : "mmol" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" } - ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasPrefix" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/milli" + "value" : "http://sbols.org/v3#TopLevel" } ] } , "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1" : { - "http://sbols.org/v3#displayId" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumericalValue" : [ { "type" : "literal" , - "value" : "measure1" + "value" : "0.1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Identified" - } - , { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/Measure" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "measure1" } ] , "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit" : [ { @@ -187,31 +210,41 @@ "value" : "https://identifiers.org/SBO:0000196" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumericalValue" : [ { - "type" : "literal" , - "value" : "0.1" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Identified" + } + , { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/Measure" } ] } , - "https://sbolstandard.org/examples/meter" : { - "http://sbols.org/v3#displayId" : [ { + "https://sbolstandard.org/examples/cubicMeter" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { "type" : "literal" , - "value" : "meter" + "value" : "m3" } ] , "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { "type" : "literal" , - "value" : "meter" + "value" : "cubicMeter" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "cubicMeter" } - , { + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasBase" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "value" : "https://sbolstandard.org/examples/meter" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasExponent" : [ { + "type" : "literal" , + "value" : "3" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -221,34 +254,29 @@ ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "meter" + "value" : "cubicMeter" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "type" : "literal" , - "value" : "m" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitExponentiation" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" } ] } , "https://sbolstandard.org/examples/milli" : { - "http://sbols.org/v3#displayId" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { "type" : "literal" , - "value" : "milli" + "value" : "m" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "0.001" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SIPrefix" - } - , { - "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "value" : "milli" } ] , "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { @@ -261,18 +289,28 @@ "value" : "Comment for the milli prefix." } ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/longcomment" : [ { + "type" : "literal" , + "value" : "This is an example long comment for the milli prefix." + } + ] , "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , "value" : "https://sbolstandard.org/examples" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeLabel" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "milli2" + "value" : "Comment for the milli prefix." + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeSymbol" : [ { + "type" : "literal" , + "value" : "m1" } , { "type" : "literal" , - "value" : "milli1" + "value" : "m2" } ] , "http://sbols.org/v3#name" : [ { @@ -280,69 +318,50 @@ "value" : "milli" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "type" : "literal" , - "value" : "m" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SIPrefix" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeSymbol" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeLabel" : [ { "type" : "literal" , - "value" : "m2" + "value" : "milli1" } , { "type" : "literal" , - "value" : "m1" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Comment for the milli prefix." + "value" : "milli2" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/longcomment" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor" : [ { "type" : "literal" , - "value" : "This is an example long comment for the milli prefix." + "value" : "0.001" } ] } , - "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" : { - "http://sbols.org/v3#displayId" : [ { + "https://sbolstandard.org/examples/millimolePerLitre" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { "type" : "literal" , - "value" : "ExternallyDefined1" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#ExternallyDefined" - } - ] , - "http://sbols.org/v3#definition" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/CHEBI:3312" + "value" : "mmol/l" } ] , - "http://sbols.org/v3#type" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000247" + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "type" : "literal" , + "value" : "millimolar" } ] , - "http://sbols.org/v3#hasMeasure" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1" - } - ] - } - , - "https://sbolstandard.org/examples/M9_Glucose_CAA" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "M9_Glucose_CAA" + "value" : "millimolePerLitre" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasDenominator" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/litre" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -350,51 +369,51 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#hasFeature" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" - } - ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "M9 Glucose CAA" + "value" : "millimolar" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "M9 Glucose CAA growth media" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitDivision" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumerator" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "https://sbolstandard.org/examples/millimole" } ] } , - "https://sbolstandard.org/examples/millimolePerLitre" : { - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasDenominator" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/litre" + "https://sbolstandard.org/examples/litre" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "type" : "literal" , + "value" : "l" } ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "millimolePerLitre" + "value" : "litre" } ] , "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { "type" : "literal" , - "value" : "millimolar" + "value" : "liter" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitDivision" + "http://www.ontology-of-units-of-measure.org/resource/om-2/comment" : [ { + "type" : "literal" , + "value" : "The litre is a unit of volume defined as 1.0e-3 cubic metre." } - , { - "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/longcomment" : [ { + "type" : "literal" , + "value" : "This is an example long comment." } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -402,93 +421,64 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumerator" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/millimole" - } - ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "millimolar" + "value" : "The litre is a unit of volume defined as 1.0e-3 cubic metre." } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeSymbol" : [ { "type" : "literal" , - "value" : "mmol/l" - } - ] - } - , - "https://sbolstandard.org/examples/kelvinMole" : { - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasTerm1" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/kelvin" + "value" : "L" } - ] , - "http://sbols.org/v3#displayId" : [ { + , { "type" : "literal" , - "value" : "kelvinMole" + "value" : "L2" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "kelvinMole" + "value" : "liter" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitMultiplication" + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" } , { "type" : "uri" , "value" : "http://sbols.org/v3#TopLevel" } ] , - "http://sbols.org/v3#hasNamespace" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , - "http://sbols.org/v3#name" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/alternativeLabel" : [ { "type" : "literal" , - "value" : "kelvinMole" + "value" : "liter" } - ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + , { "type" : "literal" , - "value" : "K mol" + "value" : "litre2" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasTerm2" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/mole" + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor" : [ { + "type" : "literal" , + "value" : "0.001" } ] } , - "https://sbolstandard.org/examples/cubicMeter" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "cubicMeter" + "https://sbolstandard.org/examples/M9_Glucose_CAA" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "cubicMeter" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitExponentiation" - } - , { - "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "value" : "M9_Glucose_CAA" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasBase" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/meter" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "M9 Glucose CAA growth media" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -496,41 +486,42 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasExponent" : [ { - "type" : "literal" , - "value" : "3" + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000241" } ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "cubicMeter" + "value" : "M9 Glucose CAA" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "type" : "literal" , - "value" : "m3" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/mole" : { - "http://sbols.org/v3#displayId" : [ { + "https://sbolstandard.org/examples/millimole" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { "type" : "literal" , - "value" : "mole" + "value" : "mmol" } ] , "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { "type" : "literal" , - "value" : "mole" + "value" : "millimole" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "millimole" } - , { + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "value" : "https://sbolstandard.org/examples/mole" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -538,14 +529,23 @@ "value" : "https://sbolstandard.org/examples" } ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasPrefix" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/milli" + } + ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "mole" + "value" : "millimole" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "type" : "literal" , - "value" : "mol" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" + } + , { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/PrefixedUnit" } ] } diff --git a/SBOL3/measurement_entity/measurement/measurement.ttl b/SBOL3/measurement_entity/measurement/measurement.ttl index 4bacb4e..9efabde 100644 --- a/SBOL3/measurement_entity/measurement/measurement.ttl +++ b/SBOL3/measurement_entity/measurement/measurement.ttl @@ -1,115 +1,115 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: - - a sbol:Identified , om:Measure ; - sbol:displayId "measure1" ; - sbol:type SBO:0000197 , SBO:0000196 ; - om:hasNumericalValue "0.1" ; - om:hasUnit :millimolePerLitre . +:litre a om:SingularUnit , sbol:TopLevel; + sbol:description "The litre is a unit of volume defined as 1.0e-3 cubic metre."; + sbol:displayId "litre"; + sbol:hasNamespace ; + sbol:name "liter"; + om:alternativeLabel "litre2" , "liter"; + om:alternativeSymbol "L" , "L2"; + om:comment "The litre is a unit of volume defined as 1.0e-3 cubic metre."; + om:hasFactor "0.001"; + om:label "liter"; + om:longcomment "This is an example long comment."; + om:symbol "l" . + +:kelvin a sbol:TopLevel , om:SingularUnit; + sbol:displayId "kelvin"; + sbol:hasNamespace ; + sbol:name "kelvin"; + om:label "kelvin"; + om:symbol "kelvin" . + +:mole a sbol:TopLevel , om:SingularUnit; + sbol:displayId "mole"; + sbol:hasNamespace ; + sbol:name "mole"; + om:label "mole"; + om:symbol "mol" . - a sbol:ExternallyDefined ; - sbol:definition CHEBI:3312 ; - sbol:displayId "ExternallyDefined1" ; - sbol:hasMeasure ; + a sbol:ExternallyDefined; + sbol:definition CHEBI:3312; + sbol:displayId "ExternallyDefined1"; + sbol:hasMeasure ; sbol:type SBO:0000247 . -:litre a sbol:TopLevel , om:SingularUnit ; - sbol:description "The litre is a unit of volume defined as 1.0e-3 cubic metre." ; - sbol:displayId "litre" ; - sbol:hasNamespace ; - sbol:name "liter" ; - om:alternativeLabel "litre2" , "liter" ; - om:alternativeSymbol "L2" , "L" ; - om:comment "The litre is a unit of volume defined as 1.0e-3 cubic metre." ; - om:hasFactor "0.001" ; - om:label "liter" ; - om:longcomment "This is an example long comment." ; - om:symbol "l" . - -:cubicMeter a sbol:TopLevel , om:UnitExponentiation ; - sbol:displayId "cubicMeter" ; - sbol:hasNamespace ; - sbol:name "cubicMeter" ; - om:hasBase :meter ; - om:hasExponent "3" ; - om:label "cubicMeter" ; - om:symbol "m3" . +:M9_Glucose_CAA a sbol:Component; + sbol:description "M9 Glucose CAA growth media"; + sbol:displayId "M9_Glucose_CAA"; + sbol:hasFeature ; + sbol:hasNamespace ; + sbol:name "M9 Glucose CAA"; + sbol:type SBO:0000241 . -:kelvin a sbol:TopLevel , om:SingularUnit ; - sbol:displayId "kelvin" ; - sbol:hasNamespace ; - sbol:name "kelvin" ; - om:label "kelvin" ; - om:symbol "kelvin" . +:millimole a sbol:TopLevel , om:PrefixedUnit; + sbol:displayId "millimole"; + sbol:hasNamespace ; + sbol:name "millimole"; + om:hasPrefix :milli; + om:hasUnit :mole; + om:label "millimole"; + om:symbol "mmol" . -:kelvinMole a sbol:TopLevel , om:UnitMultiplication ; - sbol:displayId "kelvinMole" ; - sbol:hasNamespace ; - sbol:name "kelvinMole" ; - om:hasTerm1 :kelvin ; - om:hasTerm2 :mole ; - om:label "kelvinMole" ; +:kelvinMole a sbol:TopLevel , om:UnitMultiplication; + sbol:displayId "kelvinMole"; + sbol:hasNamespace ; + sbol:name "kelvinMole"; + om:hasTerm1 :kelvin; + om:hasTerm2 :mole; + om:label "kelvinMole"; om:symbol "K mol" . -:M9_Glucose_CAA a sbol:Component ; - sbol:description "M9 Glucose CAA growth media" ; - sbol:displayId "M9_Glucose_CAA" ; - sbol:hasFeature ; - sbol:hasNamespace ; - sbol:name "M9 Glucose CAA" ; - sbol:type SBO:0000241 . - -:mole a sbol:TopLevel , om:SingularUnit ; - sbol:displayId "mole" ; - sbol:hasNamespace ; - sbol:name "mole" ; - om:label "mole" ; - om:symbol "mol" . + + a sbol:Identified , om:Measure; + sbol:displayId "measure1"; + sbol:type SBO:0000197 , SBO:0000196; + om:hasNumericalValue "0.1"; + om:hasUnit :millimolePerLitre . -:meter a sbol:TopLevel , om:SingularUnit ; - sbol:displayId "meter" ; - sbol:hasNamespace ; - sbol:name "meter" ; - om:label "meter" ; +:meter a sbol:TopLevel , om:SingularUnit; + sbol:displayId "meter"; + sbol:hasNamespace ; + sbol:name "meter"; + om:label "meter"; om:symbol "m" . -:millimolePerLitre a sbol:TopLevel , om:UnitDivision ; - sbol:displayId "millimolePerLitre" ; - sbol:hasNamespace ; - sbol:name "millimolar" ; - om:hasDenominator :litre ; - om:hasNumerator :millimole ; - om:label "millimolar" ; - om:symbol "mmol/l" . - -:millimole a sbol:TopLevel , om:PrefixedUnit ; - sbol:displayId "millimole" ; - sbol:hasNamespace ; - sbol:name "millimole" ; - om:hasPrefix :milli ; - om:hasUnit :mole ; - om:label "millimole" ; - om:symbol "mmol" . +:cubicMeter a sbol:TopLevel , om:UnitExponentiation; + sbol:displayId "cubicMeter"; + sbol:hasNamespace ; + sbol:name "cubicMeter"; + om:hasBase :meter; + om:hasExponent "3"; + om:label "cubicMeter"; + om:symbol "m3" . -:milli a om:SIPrefix , sbol:TopLevel ; - sbol:description "Comment for the milli prefix." ; - sbol:displayId "milli" ; - sbol:hasNamespace ; - sbol:name "milli" ; - om:alternativeLabel "milli1" , "milli2" ; - om:alternativeSymbol "m1" , "m2" ; - om:comment "Comment for the milli prefix." ; - om:hasFactor "0.001" ; - om:label "milli" ; - om:longcomment "This is an example long comment for the milli prefix." ; +:milli a om:SIPrefix , sbol:TopLevel; + sbol:description "Comment for the milli prefix."; + sbol:displayId "milli"; + sbol:hasNamespace ; + sbol:name "milli"; + om:alternativeLabel "milli2" , "milli1"; + om:alternativeSymbol "m2" , "m1"; + om:comment "Comment for the milli prefix."; + om:hasFactor "0.001"; + om:label "milli"; + om:longcomment "This is an example long comment for the milli prefix."; om:symbol "m" . + +:millimolePerLitre a sbol:TopLevel , om:UnitDivision; + sbol:displayId "millimolePerLitre"; + sbol:hasNamespace ; + sbol:name "millimolar"; + om:hasDenominator :litre; + om:hasNumerator :millimole; + om:label "millimolar"; + om:symbol "mmol/l" . diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld index e4f020e..9c5a7f2 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld @@ -1,52 +1,5 @@ { "@graph": [ - { - "@id": "om:milli", - "om:hasFactor": "0.001", - "sbol:name": "milli", - "om:label": "milli", - "om:symbol": "m", - "sbol:hasNamespace": { - "@id": "http://www.ontology-of-units-of-measure.org/resource/om-2" - }, - "@type": [ - "sbol:TopLevel", - "om:SIPrefix" - ], - "sbol:displayId": "milli" - }, - { - "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1", - "om:hasUnit": { - "@id": "om:millimolePerLitre" - }, - "om:hasNumericalValue": "0.1", - "@type": [ - "sbol:Identified", - "om:Measure" - ], - "sbol:displayId": "measure1" - }, - { - "@id": "om:millimolePerLitre", - "om:hasDenominator": { - "@id": "om:litre" - }, - "om:hasNumerator": { - "@id": "om:millimole" - }, - "sbol:name": "millimolar", - "om:label": "millimolar", - "om:symbol": "mmol/l", - "sbol:hasNamespace": { - "@id": "http://www.ontology-of-units-of-measure.org/resource/om-2" - }, - "@type": [ - "sbol:TopLevel", - "om:UnitDivision" - ], - "sbol:displayId": "millimolePerLitre" - }, { "@id": "om:millimole", "om:hasPrefix": { @@ -67,6 +20,21 @@ ], "sbol:displayId": "millimole" }, + { + "@id": "om:milli", + "om:hasFactor": "0.001", + "sbol:name": "milli", + "om:label": "milli", + "om:symbol": "m", + "sbol:hasNamespace": { + "@id": "http://www.ontology-of-units-of-measure.org/resource/om-2" + }, + "@type": [ + "sbol:TopLevel", + "om:SIPrefix" + ], + "sbol:displayId": "milli" + }, { "@id": "om:mole", "sbol:name": "mole", @@ -95,6 +63,18 @@ "sbol:displayId": "ExternallyDefined1", "@type": "sbol:ExternallyDefined" }, + { + "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1", + "om:hasUnit": { + "@id": "om:millimolePerLitre" + }, + "om:hasNumericalValue": "0.1", + "@type": [ + "sbol:Identified", + "om:Measure" + ], + "sbol:displayId": "measure1" + }, { "@id": "om:litre", "sbol:name": "liter", @@ -109,6 +89,26 @@ ], "sbol:displayId": "litre" }, + { + "@id": "om:millimolePerLitre", + "om:hasDenominator": { + "@id": "om:litre" + }, + "om:hasNumerator": { + "@id": "om:millimole" + }, + "sbol:name": "millimolar", + "om:label": "millimolar", + "om:symbol": "mmol/l", + "sbol:hasNamespace": { + "@id": "http://www.ontology-of-units-of-measure.org/resource/om-2" + }, + "@type": [ + "sbol:TopLevel", + "om:UnitDivision" + ], + "sbol:displayId": "millimolePerLitre" + }, { "@id": "https://sbolstandard.org/examples/M9_Glucose_CAA", "sbol:hasFeature": { diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld_expanded b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld_expanded index 47e56a7..7bee29b 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld_expanded +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.jsonld_expanded @@ -1,154 +1 @@ -[ { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/litre", - "http://sbols.org/v3#name" : [ { - "@value" : "liter" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "liter" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "l" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "litre" - } ] -}, { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/milli", - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor" : [ { - "@value" : "0.001" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "milli" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "milli" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "m" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/SIPrefix" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "milli" - } ] -}, { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/millimole", - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasPrefix" : [ { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/milli" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit" : [ { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/mole" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "millimole" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "millimole" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "mmol" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/PrefixedUnit" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "millimole" - } ] -}, { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/millimolePerLitre", - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasDenominator" : [ { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/litre" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumerator" : [ { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/millimole" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "millimolar" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "millimolar" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "mmol/l" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitDivision" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "millimolePerLitre" - } ] -}, { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/mole", - "http://sbols.org/v3#name" : [ { - "@value" : "mole" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { - "@value" : "mole" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "@value" : "mol" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "mole" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA", - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "M9 Glucose CAA growth media" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "M9 Glucose CAA" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "M9_Glucose_CAA" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1", - "http://sbols.org/v3#hasMeasure" : [ { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1" - } ], - "http://sbols.org/v3#definition" : [ { - "@id" : "https://identifiers.org/CHEBI:3312" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000247" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ExternallyDefined1" - } ], - "@type" : [ "http://sbols.org/v3#ExternallyDefined" ] -}, { - "@id" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1", - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit" : [ { - "@id" : "http://www.ontology-of-units-of-measure.org/resource/om-2/millimolePerLitre" - } ], - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumericalValue" : [ { - "@value" : "0.1" - } ], - "@type" : [ "http://sbols.org/v3#Identified", "http://www.ontology-of-units-of-measure.org/resource/om-2/Measure" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "measure1" - } ] -} ] +{"@graph":[{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2/millimole","http://www.ontology-of-units-of-measure.org/resource/om-2/hasPrefix":[{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2/milli"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit":[{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2/mole"}],"http://sbols.org/v3#name":[{"@value":"millimole"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"millimole"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"mmol"}],"http://sbols.org/v3#hasNamespace":[{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2"}],"@type":["http://sbols.org/v3#TopLevel","http://www.ontology-of-units-of-measure.org/resource/om-2/PrefixedUnit"],"http://sbols.org/v3#displayId":[{"@value":"millimole"}]},{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2/milli","http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor":[{"@value":"0.001"}],"http://sbols.org/v3#name":[{"@value":"milli"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"milli"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"m"}],"http://sbols.org/v3#hasNamespace":[{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2"}],"@type":["http://sbols.org/v3#TopLevel","http://www.ontology-of-units-of-measure.org/resource/om-2/SIPrefix"],"http://sbols.org/v3#displayId":[{"@value":"milli"}]},{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2/mole","http://sbols.org/v3#name":[{"@value":"mole"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"mole"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"mol"}],"http://sbols.org/v3#hasNamespace":[{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2"}],"@type":["http://sbols.org/v3#TopLevel","http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit"],"http://sbols.org/v3#displayId":[{"@value":"mole"}]},{"@id":"https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1","http://sbols.org/v3#hasMeasure":[{"@id":"https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1"}],"http://sbols.org/v3#definition":[{"@id":"https://identifiers.org/CHEBI:3312"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000247"}],"http://sbols.org/v3#displayId":[{"@value":"ExternallyDefined1"}],"@type":["http://sbols.org/v3#ExternallyDefined"]},{"@id":"https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1","http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit":[{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2/millimolePerLitre"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumericalValue":[{"@value":"0.1"}],"@type":["http://sbols.org/v3#Identified","http://www.ontology-of-units-of-measure.org/resource/om-2/Measure"],"http://sbols.org/v3#displayId":[{"@value":"measure1"}]},{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2/litre","http://sbols.org/v3#name":[{"@value":"liter"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"liter"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"l"}],"http://sbols.org/v3#hasNamespace":[{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2"}],"@type":["http://sbols.org/v3#TopLevel","http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit"],"http://sbols.org/v3#displayId":[{"@value":"litre"}]},{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2/millimolePerLitre","http://www.ontology-of-units-of-measure.org/resource/om-2/hasDenominator":[{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2/litre"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumerator":[{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2/millimole"}],"http://sbols.org/v3#name":[{"@value":"millimolar"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/label":[{"@value":"millimolar"}],"http://www.ontology-of-units-of-measure.org/resource/om-2/symbol":[{"@value":"mmol/l"}],"http://sbols.org/v3#hasNamespace":[{"@id":"http://www.ontology-of-units-of-measure.org/resource/om-2"}],"@type":["http://sbols.org/v3#TopLevel","http://www.ontology-of-units-of-measure.org/resource/om-2/UnitDivision"],"http://sbols.org/v3#displayId":[{"@value":"millimolePerLitre"}]},{"@id":"https://sbolstandard.org/examples/M9_Glucose_CAA","http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1"}],"http://sbols.org/v3#description":[{"@value":"M9 Glucose CAA growth media"}],"http://sbols.org/v3#name":[{"@value":"M9 Glucose CAA"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#displayId":[{"@value":"M9_Glucose_CAA"}],"@type":["http://sbols.org/v3#Component"]}]} \ No newline at end of file diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.nt b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.nt index c8276c9..88dc03f 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.nt +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.nt @@ -1,16 +1,3 @@ - "0.001" . - "milli" . - "milli" . - "m" . - . - . - "milli" . - . - . - "0.1" . - . - "measure1" . - . . . "millimole" . @@ -20,18 +7,19 @@ . "millimole" . . + "0.001" . + "milli" . + "milli" . + "m" . + . + . + "milli" . + . . . . "ExternallyDefined1" . . - "mole" . - "mole" . - "mol" . - . - . - "mole" . - . "liter" . "liter" . "l" . @@ -39,13 +27,6 @@ . "litre" . . - . - "M9 Glucose CAA growth media" . - "M9 Glucose CAA" . - . - . - "M9_Glucose_CAA" . - . . . "millimolar" . @@ -55,3 +36,22 @@ . "millimolePerLitre" . . + . + "M9 Glucose CAA growth media" . + "M9 Glucose CAA" . + . + . + "M9_Glucose_CAA" . + . + . + "0.1" . + . + "measure1" . + . + "mole" . + "mole" . + "mol" . + . + . + "mole" . + . diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rdf b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rdf index 0ef58f6..0eb45d1 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rdf +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rdf @@ -42,18 +42,6 @@ litre - - - - - - millimolar - millimolar - mmol/l - - millimolePerLitre - - 0.001 milli @@ -81,4 +69,14 @@ millimole + + + + millimolar + millimolar + mmol/l + + millimolePerLitre + + diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rj b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rj index 2f5c372..ed8dc2e 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rj +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.rj @@ -1,64 +1,46 @@ { - "http://www.ontology-of-units-of-measure.org/resource/om-2/litre" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "litre" + "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" : { + "http://sbols.org/v3#definition" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/CHEBI:3312" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "liter" + "value" : "ExternallyDefined1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" - } - , { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "value" : "https://identifiers.org/SBO:0000247" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#hasMeasure" : [ { "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "liter" + "value" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "type" : "literal" , - "value" : "l" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#ExternallyDefined" } ] } , - "http://www.ontology-of-units-of-measure.org/resource/om-2/millimolePerLitre" : { - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasDenominator" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/litre" - } - ] , - "http://sbols.org/v3#displayId" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/litre" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { "type" : "literal" , - "value" : "millimolePerLitre" + "value" : "l" } ] , "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { "type" : "literal" , - "value" : "millimolar" + "value" : "liter" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitDivision" - } - , { - "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "litre" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -66,48 +48,38 @@ "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumerator" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/millimole" - } - ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "millimolar" + "value" : "liter" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "type" : "literal" , - "value" : "mmol/l" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" } ] } , "http://www.ontology-of-units-of-measure.org/resource/om-2/milli" : { - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { "type" : "literal" , - "value" : "0.001" + "value" : "m" } ] , - "http://sbols.org/v3#displayId" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { "type" : "literal" , "value" : "milli" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "milli" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SIPrefix" - } - , { - "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" - } - ] , "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2" @@ -118,17 +90,26 @@ "value" : "milli" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SIPrefix" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasFactor" : [ { "type" : "literal" , - "value" : "m" + "value" : "0.001" } ] } , "http://www.ontology-of-units-of-measure.org/resource/om-2/mole" : { - "http://sbols.org/v3#displayId" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { "type" : "literal" , - "value" : "mole" + "value" : "mol" } ] , "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { @@ -136,13 +117,9 @@ "value" : "mole" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" - } - , { - "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "mole" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -155,72 +132,48 @@ "value" : "mole" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "type" : "literal" , - "value" : "mol" - } - ] - } - , - "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "measure1" - } - ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Identified" + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/SingularUnit" } , { "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/Measure" - } - ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/millimolePerLitre" - } - ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumericalValue" : [ { - "type" : "literal" , - "value" : "0.1" + "value" : "http://sbols.org/v3#TopLevel" } ] } , - "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" : { - "http://sbols.org/v3#displayId" : [ { + "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumericalValue" : [ { "type" : "literal" , - "value" : "ExternallyDefined1" + "value" : "0.1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#ExternallyDefined" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "measure1" } ] , - "http://sbols.org/v3#definition" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit" : [ { "type" : "uri" , - "value" : "https://identifiers.org/CHEBI:3312" + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/millimolePerLitre" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000247" + "value" : "http://sbols.org/v3#Identified" } - ] , - "http://sbols.org/v3#hasMeasure" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1/measure1" + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/Measure" } ] } , "http://www.ontology-of-units-of-measure.org/resource/om-2/millimole" : { - "http://sbols.org/v3#displayId" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { "type" : "literal" , - "value" : "millimole" + "value" : "mmol" } ] , "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { @@ -228,13 +181,9 @@ "value" : "millimole" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/PrefixedUnit" - } - , { - "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "millimole" } ] , "http://www.ontology-of-units-of-measure.org/resource/om-2/hasUnit" : [ { @@ -247,32 +196,41 @@ "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2" } ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasPrefix" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/milli" + } + ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , "value" : "millimole" } ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { - "type" : "literal" , - "value" : "mmol" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" } - ] , - "http://www.ontology-of-units-of-measure.org/resource/om-2/hasPrefix" : [ { + , { "type" : "uri" , - "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/milli" + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/PrefixedUnit" } ] } , "https://sbolstandard.org/examples/M9_Glucose_CAA" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "M9_Glucose_CAA" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "M9 Glucose CAA growth media" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -280,9 +238,9 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#hasFeature" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/M9_Glucose_CAA/ExternallyDefined1" + "value" : "https://identifiers.org/SBO:0000241" } ] , "http://sbols.org/v3#name" : [ { @@ -290,14 +248,56 @@ "value" : "M9 Glucose CAA" } ] , - "http://sbols.org/v3#description" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "http://www.ontology-of-units-of-measure.org/resource/om-2/millimolePerLitre" : { + "http://www.ontology-of-units-of-measure.org/resource/om-2/symbol" : [ { "type" : "literal" , - "value" : "M9 Glucose CAA growth media" + "value" : "mmol/l" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.ontology-of-units-of-measure.org/resource/om-2/label" : [ { + "type" : "literal" , + "value" : "millimolar" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "millimolePerLitre" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasDenominator" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/litre" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "millimolar" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/UnitDivision" + } + , { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" + } + ] , + "http://www.ontology-of-units-of-measure.org/resource/om-2/hasNumerator" : [ { + "type" : "uri" , + "value" : "http://www.ontology-of-units-of-measure.org/resource/om-2/millimole" } ] } diff --git a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.ttl b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.ttl index 64a9c43..0ffa80e 100644 --- a/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.ttl +++ b/SBOL3/measurement_entity/measurement_using_units_From_OM/measurement_using_units_From_OM.ttl @@ -1,71 +1,71 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: -om:milli a sbol:TopLevel , om:SIPrefix ; - sbol:displayId "milli" ; - sbol:hasNamespace ; - sbol:name "milli" ; - om:hasFactor "0.001" ; - om:label "milli" ; - om:symbol "m" . - - - a sbol:Identified , om:Measure ; - sbol:displayId "measure1" ; - om:hasNumericalValue "0.1" ; - om:hasUnit om:millimolePerLitre . - -om:millimole a sbol:TopLevel , om:PrefixedUnit ; - sbol:displayId "millimole" ; - sbol:hasNamespace ; - sbol:name "millimole" ; - om:hasPrefix om:milli ; - om:hasUnit om:mole ; - om:label "millimole" ; +om:millimole a sbol:TopLevel , om:PrefixedUnit; + sbol:displayId "millimole"; + sbol:hasNamespace ; + sbol:name "millimole"; + om:hasPrefix om:milli; + om:hasUnit om:mole; + om:label "millimole"; om:symbol "mmol" . +om:milli a sbol:TopLevel , om:SIPrefix; + sbol:displayId "milli"; + sbol:hasNamespace ; + sbol:name "milli"; + om:hasFactor "0.001"; + om:label "milli"; + om:symbol "m" . + - a sbol:ExternallyDefined ; - sbol:definition CHEBI:3312 ; - sbol:displayId "ExternallyDefined1" ; - sbol:hasMeasure ; + a sbol:ExternallyDefined; + sbol:definition CHEBI:3312; + sbol:displayId "ExternallyDefined1"; + sbol:hasMeasure ; sbol:type SBO:0000247 . -om:mole a sbol:TopLevel , om:SingularUnit ; - sbol:displayId "mole" ; - sbol:hasNamespace ; - sbol:name "mole" ; - om:label "mole" ; - om:symbol "mol" . - -om:litre a sbol:TopLevel , om:SingularUnit ; - sbol:displayId "litre" ; - sbol:hasNamespace ; - sbol:name "liter" ; - om:label "liter" ; +om:litre a sbol:TopLevel , om:SingularUnit; + sbol:displayId "litre"; + sbol:hasNamespace ; + sbol:name "liter"; + om:label "liter"; om:symbol "l" . -:M9_Glucose_CAA a sbol:Component ; - sbol:description "M9 Glucose CAA growth media" ; - sbol:displayId "M9_Glucose_CAA" ; - sbol:hasFeature ; - sbol:hasNamespace ; - sbol:name "M9 Glucose CAA" ; +om:millimolePerLitre a sbol:TopLevel , om:UnitDivision; + sbol:displayId "millimolePerLitre"; + sbol:hasNamespace ; + sbol:name "millimolar"; + om:hasDenominator om:litre; + om:hasNumerator om:millimole; + om:label "millimolar"; + om:symbol "mmol/l" . + +:M9_Glucose_CAA a sbol:Component; + sbol:description "M9 Glucose CAA growth media"; + sbol:displayId "M9_Glucose_CAA"; + sbol:hasFeature ; + sbol:hasNamespace ; + sbol:name "M9 Glucose CAA"; sbol:type SBO:0000241 . -om:millimolePerLitre a sbol:TopLevel , om:UnitDivision ; - sbol:displayId "millimolePerLitre" ; - sbol:hasNamespace ; - sbol:name "millimolar" ; - om:hasDenominator om:litre ; - om:hasNumerator om:millimole ; - om:label "millimolar" ; - om:symbol "mmol/l" . + + a sbol:Identified , om:Measure; + sbol:displayId "measure1"; + om:hasNumericalValue "0.1"; + om:hasUnit om:millimolePerLitre . + +om:mole a sbol:TopLevel , om:SingularUnit; + sbol:displayId "mole"; + sbol:hasNamespace ; + sbol:name "mole"; + om:label "mole"; + om:symbol "mol" . diff --git a/SBOL3/multicellular/multicellular.jsonld b/SBOL3/multicellular/multicellular.jsonld index c379b56..078ed43 100644 --- a/SBOL3/multicellular/multicellular.jsonld +++ b/SBOL3/multicellular/multicellular.jsonld @@ -1,148 +1,170 @@ { "@graph": [ { - "@id": "https://sbolstandard.org/examples/rbs_luxR", - "sbol:type": { - "@id": "SBO:0000251" - }, + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1", "sbol:role": { - "@id": "SO:0000139" + "@id": "SBO:0000645" }, - "sbol:name": "rbs", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" }, - "sbol:displayId": "rbs_luxR", - "sbol:description": "RBS", - "@type": "sbol:Component" + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent3", + "sbol:orientation": { + "@id": "SO:0001030" + }, "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/AHL" + "@id": "https://sbolstandard.org/examples/luxR" }, - "sbol:displayId": "SubComponent2", + "sbol:displayId": "SubComponent3", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/AHL", - "sbol:type": { - "@id": "SBO:0000247" + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" }, - "sbol:role": { - "@id": "CHEBI:35224" + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" }, - "sbol:name": "AHL", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" + "sbol:displayId": "ComponentReference2", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/AHL" }, - "sbol:displayId": "AHL", - "sbol:description": "AHL", - "@type": "sbol:Component" + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2", - "sbol:type": { - "@id": "SBO:0000589" + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem" }, - "sbol:hasParticipation": [ - { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1" - }, - { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2" - } - ], - "sbol:displayId": "Interaction2", - "@type": "sbol:Interaction" + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1", - "sbol:role": { - "@id": "SBO:0000645" + "@id": "https://sbolstandard.org/examples/MulticellularSystem/Constraint1", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" + "sbol:restriction": { + "@id": "sbol:verifyIdentical" }, - "sbol:displayId": "Participation1", - "@type": "sbol:Participation" + "sbol:object": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2", - "sbol:role": { - "@id": "SBO:0000011" + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" }, - "sbol:displayId": "Participation2", - "@type": "sbol:Participation" + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2", + "@id": "https://sbolstandard.org/examples/gfp", + "sbol:type": { + "@id": "SBO:0000251" + }, "sbol:role": { - "@id": "SBO:0000011" + "@id": "SO:0000316" }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" + "sbol:name": "gfp", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "Participation2", - "@type": "sbol:Participation" + "sbol:displayId": "gfp", + "sbol:description": "gfp coding sequence", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent10", + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent12", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/LuxR_protein" + "@id": "https://sbolstandard.org/examples/LuxR_AHL" }, - "sbol:displayId": "SubComponent10", + "sbol:displayId": "SubComponent12", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", - "sbol:refersTo": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + "@id": "https://sbolstandard.org/examples/LuxR_AHL", + "sbol:type": { + "@id": "SBO:0000252" }, - "sbol:inChildOf": { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" + "sbol:role": { + "@id": "GO:0003700" }, - "sbol:displayId": "ComponentReference2", - "@type": "sbol:ComponentReference" - }, - { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem" + "sbol:name": "LuxR_AHL", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "SubComponent2", - "@type": "sbol:SubComponent" + "sbol:displayId": "LuxR_AHL", + "sbol:description": "LuxR_AHL complex", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent11", + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent4", + "sbol:orientation": { + "@id": "SO:0001030" + }, "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/GFP_protein" + "@id": "https://sbolstandard.org/examples/ter_luxR" }, - "sbol:displayId": "SubComponent11", + "sbol:displayId": "SubComponent4", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2", + "@id": "https://sbolstandard.org/examples/ter_luxR", + "sbol:type": { + "@id": "SBO:0000251" + }, "sbol:role": { - "@id": "SBO:0000459" + "@id": "SO:0000141" }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" + "sbol:name": "luxR terminator", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "Participation2", - "@type": "sbol:Participation" + "sbol:displayId": "ter_luxR", + "sbol:description": "Terminator", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent12", + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/LuxR_AHL" + "@id": "https://sbolstandard.org/examples/AHL" }, - "sbol:displayId": "SubComponent12", + "sbol:displayId": "SubComponent2", "@type": "sbol:SubComponent" }, + { + "@id": "https://sbolstandard.org/examples/AHL", + "sbol:type": { + "@id": "SBO:0000247" + }, + "sbol:role": { + "@id": "CHEBI:35224" + }, + "sbol:name": "AHL", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "AHL", + "sbol:description": "AHL", + "@type": "sbol:Component" + }, { "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2", "sbol:role": { @@ -163,134 +185,48 @@ "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/MulticellularSystem", - "sbol:hasFeature": [ - { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" - }, - { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" - }, - { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" - }, - { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" - } - ], - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, + "@id": "https://sbolstandard.org/examples/GFP_protein", "sbol:type": { - "@id": "SBO:0000241" - }, - "sbol:description": "Multicellular System", - "@type": "sbol:Component", - "sbol:hasConstraint": { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" + "@id": "SBO:0000252" }, - "sbol:role": { - "@id": "SBO:0000289" + "sbol:name": "GFP", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "sbol:name": "MulticellularSystem", - "sbol:displayId": "MulticellularSystem" + "sbol:displayId": "GFP_protein", + "sbol:description": "GFP", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/Constraint1", + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint2", "sbol:subject": { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" }, "sbol:restriction": { - "@id": "sbol:verifyIdentical" + "@id": "sbol:contains" }, "sbol:object": { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" }, - "sbol:displayId": "Constraint1", + "sbol:displayId": "Constraint2", "@type": "sbol:Constraint" }, { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/SenderSystem" + "@id": "https://sbolstandard.org/examples/OrganismB" }, "sbol:displayId": "SubComponent1", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1", - "sbol:refersTo": { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - }, - "sbol:inChildOf": { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" - }, - "sbol:displayId": "ComponentReference1", - "@type": "sbol:ComponentReference" - }, - { - "@id": "https://sbolstandard.org/examples/SenderSystem", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:hasFeature": [ - { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" - }, - { - "@id": "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" - }, - { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent3" - }, - { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - } - ], - "sbol:description": "Sender System", - "sbol:hasConstraint": [ - { - "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint1" - }, - { - "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint3" - }, - { - "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint2" - } - ], - "sbol:name": "SenderSystem", - "sbol:displayId": "SenderSystem", - "@type": "sbol:Component", - "sbol:role": { - "@id": "SBO:0000289" - }, - "sbol:type": { - "@id": "SBO:0000241" - } - }, - { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1", + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/OrganismA" + "@id": "https://sbolstandard.org/examples/AHL_receiver" }, - "sbol:displayId": "SubComponent1", + "sbol:displayId": "SubComponent3", "@type": "sbol:SubComponent" }, - { - "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint1", - "sbol:subject": { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" - }, - "sbol:restriction": { - "@id": "sbol:contains" - }, - "sbol:object": { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - }, - "sbol:displayId": "Constraint1", - "@type": "sbol:Constraint" - }, { "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint3", "sbol:subject": { @@ -305,20 +241,6 @@ "sbol:displayId": "Constraint3", "@type": "sbol:Constraint" }, - { - "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint2", - "sbol:subject": { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" - }, - "sbol:restriction": { - "@id": "sbol:contains" - }, - "sbol:object": { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent3" - }, - "sbol:displayId": "Constraint2", - "@type": "sbol:Constraint" - }, { "@id": "https://sbolstandard.org/examples/SenderSystem/ComponentReference1", "sbol:refersTo": { @@ -331,99 +253,45 @@ "@type": "sbol:ComponentReference" }, { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent3", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/AHL_producer" - }, - "sbol:displayId": "SubComponent3", - "@type": "sbol:SubComponent" - }, - { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/AHL" - }, - "sbol:displayId": "SubComponent2", - "@type": "sbol:SubComponent" - }, - { - "@id": "https://sbolstandard.org/examples/AHL_producer", - "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:description": "AHL producer", + "@id": "https://sbolstandard.org/examples/MulticellularSystem", "sbol:hasFeature": [ { - "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent3" - }, - { - "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent2" + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" }, { - "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent1" + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" }, { - "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent4" + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" }, { - "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent5" + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" } ], - "sbol:displayId": "AHL_producer", - "sbol:hasInteraction": { - "@id": "https://sbolstandard.org/examples/AHL_producer/Interaction1" - }, - "sbol:role": { - "@id": "SO:0000704" - }, - "@type": "sbol:Component", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:name": "AHL producer" - }, - { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent5", - "sbol:orientation": { - "@id": "SO:0001030" - }, - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/pLuxR" - }, - "sbol:displayId": "SubComponent5", - "@type": "sbol:SubComponent" - }, - { - "@id": "https://sbolstandard.org/examples/pLuxR", "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:role": { - "@id": "SO:0000167" + "@id": "SBO:0000241" }, - "sbol:name": "pLuxR", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "pLuxR", - "sbol:description": "LuxR inducible promoter", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/ter_gfp", - "sbol:type": { - "@id": "SBO:0000251" - }, + "sbol:name": "MulticellularSystem", + "sbol:description": "Multicellular System", "sbol:role": { - "@id": "SO:0000141" + "@id": "SBO:0000289" }, - "sbol:name": "gfp terminator", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" + "sbol:displayId": "MulticellularSystem", + "@type": "sbol:Component", + "sbol:hasConstraint": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" + } + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/SenderSystem" }, - "sbol:displayId": "ter_gfp", - "sbol:description": "Terminator", - "@type": "sbol:Component" + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" }, { "@id": "https://sbolstandard.org/examples/AHL_producer/Interaction1", @@ -480,58 +348,118 @@ "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent1", + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1", + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent7", "sbol:orientation": { "@id": "SO:0001030" }, "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/pConstLuxI" + "@id": "https://sbolstandard.org/examples/gfp" }, - "sbol:displayId": "SubComponent1", + "sbol:displayId": "SubComponent7", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/pConstLuxI", + "@id": "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent6", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_gfp" + }, + "sbol:displayId": "SubComponent6", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent2", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_luxI" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/rbs_luxI", "sbol:type": { "@id": "SBO:0000251" }, "sbol:role": { - "@id": "SO:0000167" + "@id": "SO:0000139" }, - "sbol:name": "pConstLuxI", + "sbol:name": "rbs", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "pConstLuxI", - "sbol:description": "Constitutive promoter", + "sbol:displayId": "rbs_luxI", + "sbol:description": "RBS", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/luxR", + "@id": "https://sbolstandard.org/examples/luxI", "sbol:type": { "@id": "SBO:0000251" }, "sbol:role": { "@id": "SO:0000316" }, - "sbol:name": "luxR", + "sbol:name": "luxI", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "luxR", - "sbol:description": "luxR coding sequence", + "sbol:displayId": "luxI", + "sbol:description": "luxI coding sequence", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1", + "@id": "https://sbolstandard.org/examples/OrganismB", + "sbol:type": { + "@id": "GO:0005623" + }, "sbol:role": { - "@id": "SBO:0000643" + "@id": "SBO:0000290" }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" + "sbol:name": "OrganismB", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "Participation1", - "@type": "sbol:Participation" + "sbol:displayId": "OrganismB", + "sbol:description": "Organism B", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/pConstLuxR" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" }, { "@id": "https://sbolstandard.org/examples/pConstLuxR", @@ -550,173 +478,316 @@ "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1", + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1", + "sbol:role": { + "@id": "SBO:0000643" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent5", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/pLuxR" + }, + "sbol:displayId": "SubComponent5", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2", "sbol:type": { "@id": "SBO:0000589" }, "sbol:hasParticipation": [ { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1" + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2" + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2" } ], - "sbol:displayId": "Interaction1", + "sbol:displayId": "Interaction2", "@type": "sbol:Interaction" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1", - "sbol:role": { - "@id": "SBO:0000645" + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent8", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ter_gfp" + }, + "sbol:displayId": "SubComponent8", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/ter_gfp", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "gfp terminator", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "ter_gfp", + "sbol:description": "Terminator", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent4", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ter_luxI" + }, + "sbol:displayId": "SubComponent4", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/ter_luxI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "luxI terminator", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "ter_luxI", + "sbol:description": "Terminator", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem", + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + } + ], + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:type": { + "@id": "SBO:0000241" + }, + "sbol:hasConstraint": [ + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint2" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint3" + } + ], + "sbol:displayId": "ReceiverSystem", + "sbol:role": { + "@id": "SBO:0000289" + }, + "@type": "sbol:Component", + "sbol:description": "Receiver System", + "sbol:name": "ReceiverSystem" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint1", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + }, + "sbol:restriction": { + "@id": "sbol:contains" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint3", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" + "sbol:restriction": { + "@id": "sbol:verifyIdentical" }, - "sbol:displayId": "Participation1", - "@type": "sbol:Participation" + "sbol:object": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + }, + "sbol:displayId": "Constraint3", + "@type": "sbol:Constraint" }, { "@id": "https://sbolstandard.org/examples/AHL_receiver", - "sbol:hasInteraction": [ + "sbol:name": "AHL receiver", + "sbol:hasFeature": [ { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4" + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1" + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent6" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2" + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3" - } - ], - "sbol:hasFeature": [ - { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent2" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent4" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent6" + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent8" + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" }, { "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent1" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent8" + } + ], + "sbol:description": "AHL receiver", + "sbol:hasInteraction": [ + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent2" + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction2" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent4" + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4" } ], - "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:name": "AHL receiver", - "@type": "sbol:Component", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, "sbol:displayId": "AHL_receiver", + "@type": "sbol:Component", + "sbol:type": { + "@id": "SBO:0000251" + }, "sbol:role": { "@id": "SO:0000704" - }, - "sbol:description": "AHL receiver" + } }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4", - "sbol:type": { - "@id": "SBO:0000177" + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent5", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/AHL" }, - "sbol:hasParticipation": [ - { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1" - }, - { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2" - }, - { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3" - } - ], - "sbol:displayId": "Interaction4", - "@type": "sbol:Interaction" + "sbol:displayId": "SubComponent5", + "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent7", - "sbol:orientation": { - "@id": "SO:0001030" + "@id": "https://sbolstandard.org/examples/luxR", + "sbol:type": { + "@id": "SBO:0000251" }, - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/gfp" + "sbol:role": { + "@id": "SO:0000316" }, - "sbol:displayId": "SubComponent7", - "@type": "sbol:SubComponent" + "sbol:name": "luxR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "luxR", + "sbol:description": "luxR coding sequence", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent6", - "sbol:orientation": { - "@id": "SO:0001030" - }, + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent11", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/rbs_gfp" + "@id": "https://sbolstandard.org/examples/GFP_protein" }, - "sbol:displayId": "SubComponent6", + "sbol:displayId": "SubComponent11", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent8", - "sbol:orientation": { - "@id": "SO:0001030" + "@id": "https://sbolstandard.org/examples/LuxR_protein", + "sbol:type": { + "@id": "SBO:0000252" }, - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/ter_gfp" + "sbol:role": { + "@id": "GO:0003700" }, - "sbol:displayId": "SubComponent8", - "@type": "sbol:SubComponent" + "sbol:name": "LuxR_protein", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "LuxR_protein", + "sbol:description": "LuxR", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent1", - "sbol:orientation": { - "@id": "SO:0001030" - }, + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/pConstLuxR" + "@id": "https://sbolstandard.org/examples/OrganismA" }, "sbol:displayId": "SubComponent1", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent3", - "sbol:orientation": { - "@id": "SO:0001030" + "@id": "https://sbolstandard.org/examples/OrganismA", + "sbol:type": { + "@id": "GO:0005623" }, - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/luxR" + "sbol:role": { + "@id": "SBO:0000290" }, - "sbol:displayId": "SubComponent3", - "@type": "sbol:SubComponent" + "sbol:name": "OrganismA", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "OrganismA", + "sbol:description": "Organism A", + "@type": "sbol:Component" }, { "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent2", @@ -730,15 +801,20 @@ "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent4", - "sbol:orientation": { - "@id": "SO:0001030" - }, - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/ter_luxR" + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1", + "sbol:type": { + "@id": "SBO:0000589" }, - "sbol:displayId": "SubComponent4", - "@type": "sbol:SubComponent" + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2" + } + ], + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" }, { "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3", @@ -757,191 +833,195 @@ "@type": "sbol:Interaction" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/OrganismB" - }, - "sbol:displayId": "SubComponent1", - "@type": "sbol:SubComponent" - }, - { - "@id": "https://sbolstandard.org/examples/OrganismB", + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4", "sbol:type": { - "@id": "GO:0005623" - }, - "sbol:role": { - "@id": "SBO:0000290" - }, - "sbol:name": "OrganismB", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "OrganismB", - "sbol:description": "Organism B", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1", - "sbol:role": { - "@id": "SBO:0000010" - }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" + "@id": "SBO:0000177" }, - "sbol:displayId": "Participation1", - "@type": "sbol:Participation" + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3" + } + ], + "sbol:displayId": "Interaction4", + "@type": "sbol:Interaction" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint3", - "sbol:subject": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" - }, - "sbol:restriction": { - "@id": "sbol:verifyIdentical" - }, - "sbol:object": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent10", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LuxR_protein" }, - "sbol:displayId": "Constraint3", - "@type": "sbol:Constraint" + "sbol:displayId": "SubComponent10", + "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1", - "sbol:refersTo": { - "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1", + "sbol:role": { + "@id": "SBO:0000010" }, - "sbol:inChildOf": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" }, - "sbol:displayId": "ComponentReference1", - "@type": "sbol:ComponentReference" + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/ter_luxR", + "@id": "https://sbolstandard.org/examples/pConstLuxI", "sbol:type": { "@id": "SBO:0000251" }, "sbol:role": { - "@id": "SO:0000141" + "@id": "SO:0000167" }, - "sbol:name": "luxR terminator", + "sbol:name": "pConstLuxI", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "ter_luxR", - "sbol:description": "Terminator", + "sbol:displayId": "pConstLuxI", + "sbol:description": "Constitutive promoter", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint2", + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" + }, + "sbol:displayId": "Participation3", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint2", "sbol:subject": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" }, "sbol:restriction": { "@id": "sbol:contains" }, "sbol:object": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent3" }, "sbol:displayId": "Constraint2", "@type": "sbol:Constraint" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3", + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent3", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/AHL_receiver" + "@id": "https://sbolstandard.org/examples/AHL_producer" }, "sbol:displayId": "SubComponent3", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent5", + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent1", + "sbol:orientation": { + "@id": "SO:0001030" + }, "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/AHL" + "@id": "https://sbolstandard.org/examples/pConstLuxI" }, - "sbol:displayId": "SubComponent5", + "sbol:displayId": "SubComponent1", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/OrganismA", + "@id": "https://sbolstandard.org/examples/pLuxR", "sbol:type": { - "@id": "GO:0005623" + "@id": "SBO:0000251" }, "sbol:role": { - "@id": "SBO:0000290" + "@id": "SO:0000167" }, - "sbol:name": "OrganismA", + "sbol:name": "pLuxR", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "OrganismA", - "sbol:description": "Organism A", + "sbol:displayId": "pLuxR", + "sbol:description": "LuxR inducible promoter", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/LuxR_protein", - "sbol:type": { - "@id": "SBO:0000252" + "@id": "https://sbolstandard.org/examples/AHL_producer", + "sbol:hasInteraction": { + "@id": "https://sbolstandard.org/examples/AHL_producer/Interaction1" }, + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent4" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent5" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent3" + } + ], + "sbol:name": "AHL producer", "sbol:role": { - "@id": "GO:0003700" - }, - "sbol:name": "LuxR_protein", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" + "@id": "SO:0000704" }, - "sbol:displayId": "LuxR_protein", - "sbol:description": "LuxR", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/gfp", + "sbol:description": "AHL producer", "sbol:type": { "@id": "SBO:0000251" }, - "sbol:role": { - "@id": "SO:0000316" - }, - "sbol:name": "gfp", + "@type": "sbol:Component", + "sbol:displayId": "AHL_producer", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "gfp", - "sbol:description": "gfp coding sequence", - "@type": "sbol:Component" + } }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem", + "@id": "https://sbolstandard.org/examples/SenderSystem", + "sbol:description": "Sender System", "sbol:role": { "@id": "SBO:0000289" }, - "sbol:description": "Receiver System", "sbol:hasFeature": [ { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent3" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + "@id": "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" } ], - "sbol:name": "ReceiverSystem", - "@type": "sbol:Component", - "sbol:displayId": "ReceiverSystem", "sbol:hasConstraint": [ { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint3" + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint3" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint2" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint2" + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint1" } ], "sbol:type": { @@ -949,142 +1029,62 @@ }, "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" - } + }, + "sbol:displayId": "SenderSystem", + "sbol:name": "SenderSystem", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint1", + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint1", "sbol:subject": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" }, "sbol:restriction": { "@id": "sbol:contains" }, "sbol:object": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" }, "sbol:displayId": "Constraint1", "@type": "sbol:Constraint" }, { - "@id": "https://sbolstandard.org/examples/LuxR_AHL", - "sbol:type": { - "@id": "SBO:0000252" - }, - "sbol:role": { - "@id": "GO:0003700" - }, - "sbol:name": "LuxR_AHL", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "LuxR_AHL", - "sbol:description": "LuxR_AHL complex", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/rbs_luxI", - "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:role": { - "@id": "SO:0000139" - }, - "sbol:name": "rbs", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "rbs_luxI", - "sbol:description": "RBS", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent4", + "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent3", "sbol:orientation": { "@id": "SO:0001030" }, "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/ter_luxI" + "@id": "https://sbolstandard.org/examples/luxI" }, - "sbol:displayId": "SubComponent4", + "sbol:displayId": "SubComponent3", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/ter_luxI", + "@id": "https://sbolstandard.org/examples/rbs_luxR", "sbol:type": { "@id": "SBO:0000251" }, "sbol:role": { - "@id": "SO:0000141" + "@id": "SO:0000139" }, - "sbol:name": "luxI terminator", + "sbol:name": "rbs", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "ter_luxI", - "sbol:description": "Terminator", + "sbol:displayId": "rbs_luxR", + "sbol:description": "RBS", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent3", - "sbol:orientation": { - "@id": "SO:0001030" - }, - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/luxI" - }, - "sbol:displayId": "SubComponent3", - "@type": "sbol:SubComponent" - }, - { - "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3", + "@id": "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2", "sbol:role": { - "@id": "SBO:0000011" + "@id": "SBO:0000459" }, "sbol:participant": { "@id": "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" }, - "sbol:displayId": "Participation3", + "sbol:displayId": "Participation2", "@type": "sbol:Participation" - }, - { - "@id": "https://sbolstandard.org/examples/GFP_protein", - "sbol:type": { - "@id": "SBO:0000252" - }, - "sbol:name": "GFP", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "GFP_protein", - "sbol:description": "GFP", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/luxI", - "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:role": { - "@id": "SO:0000316" - }, - "sbol:name": "luxI", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "luxI", - "sbol:description": "luxI coding sequence", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/AHL_producer/SubComponent2", - "sbol:orientation": { - "@id": "SO:0001030" - }, - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/rbs_luxI" - }, - "sbol:displayId": "SubComponent2", - "@type": "sbol:SubComponent" } ], "@context": { diff --git a/SBOL3/multicellular/multicellular.jsonld_expanded b/SBOL3/multicellular/multicellular.jsonld_expanded index 311dc1d..98263f7 100644 --- a/SBOL3/multicellular/multicellular.jsonld_expanded +++ b/SBOL3/multicellular/multicellular.jsonld_expanded @@ -1,1191 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/AHL", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000247" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/CHEBI:35224" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "AHL" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "AHL" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "AHL" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_producer", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "AHL producer" - } ], - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent3" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent2" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent4" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "AHL_producer" - } ], - "http://sbols.org/v3#hasInteraction" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_producer/Interaction1" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000704" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "AHL producer" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/Interaction1", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000589" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation1" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction1" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000645" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent3" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000011" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent1", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/pConstLuxI" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent2", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/rbs_luxI" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent3", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/luxI" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent3" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent4", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/ter_luxI" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent4" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/AHL" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent5" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver", - "http://sbols.org/v3#hasInteraction" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3" - } ], - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent6" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent8" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent2" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent4" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "AHL receiver" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "AHL_receiver" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000704" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "AHL receiver" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000589" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction1" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000645" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000011" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000589" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction2" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000645" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000011" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000170" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction3" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000643" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000459" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000177" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2" - }, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction4" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000010" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000010" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000011" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation3" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent1", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/pConstLuxR" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/LuxR_protein" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent10" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent11", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/GFP_protein" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent11" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/LuxR_AHL" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent12" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent2", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/rbs_luxR" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent3", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/luxR" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent3" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent4", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/ter_luxR" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent4" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent5", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/pLuxR" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent5" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent6", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/rbs_gfp" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent6" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent7", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/gfp" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent7" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent8", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/ter_gfp" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent8" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/AHL" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent9" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/GFP_protein", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "GFP" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "GFP_protein" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "GFP" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/LuxR_AHL", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/GO:0003700" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "LuxR_AHL" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "LuxR_AHL" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "LuxR_AHL complex" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/LuxR_protein", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/GO:0003700" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "LuxR_protein" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "LuxR_protein" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "LuxR" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem", - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Multicellular System" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#hasConstraint" : [ { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000289" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "MulticellularSystem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "MulticellularSystem" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1", - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - } ], - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference1" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - } ], - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference2" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/Constraint1", - "http://sbols.org/v3#subject" : [ { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#verifyIdentical" - } ], - "http://sbols.org/v3#object" : [ { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint1" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/OrganismA", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/GO:0005623" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000290" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "OrganismA" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "OrganismA" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Organism A" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/OrganismB", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/GO:0005623" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000290" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "OrganismB" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "OrganismB" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Organism B" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000289" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Receiver System" - } ], - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "ReceiverSystem" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ReceiverSystem" - } ], - "http://sbols.org/v3#hasConstraint" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint3" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint2" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1", - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" - } ], - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference1" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint1", - "http://sbols.org/v3#subject" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#contains" - } ], - "http://sbols.org/v3#object" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint1" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint2", - "http://sbols.org/v3#subject" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#contains" - } ], - "http://sbols.org/v3#object" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint2" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint3", - "http://sbols.org/v3#subject" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#verifyIdentical" - } ], - "http://sbols.org/v3#object" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint3" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/OrganismB" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/AHL" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_receiver" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent3" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/SenderSystem", - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Sender System" - } ], - "http://sbols.org/v3#hasConstraint" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/Constraint1" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/Constraint3" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/Constraint2" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "SenderSystem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SenderSystem" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000289" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/ComponentReference1", - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5" - } ], - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference1" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/Constraint1", - "http://sbols.org/v3#subject" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#contains" - } ], - "http://sbols.org/v3#object" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint1" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/Constraint2", - "http://sbols.org/v3#subject" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#contains" - } ], - "http://sbols.org/v3#object" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint2" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/Constraint3", - "http://sbols.org/v3#subject" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#verifyIdentical" - } ], - "http://sbols.org/v3#object" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint3" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/OrganismA" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/AHL" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/AHL_producer" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent3" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/gfp", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000316" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "gfp" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "gfp" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "gfp coding sequence" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/luxI", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000316" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "luxI" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "luxI" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "luxI coding sequence" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/luxR", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000316" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "luxR" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "luxR" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "luxR coding sequence" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/pConstLuxI", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000167" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "pConstLuxI" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "pConstLuxI" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Constitutive promoter" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/pConstLuxR", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000167" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "pLuxR" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "pConstLuxR" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Constituve promoter" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/pLuxR", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000167" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "pLuxR" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "pLuxR" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "LuxR inducible promoter" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/rbs_gfp", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000139" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "rbs" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "rbs_gfp" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "RBS" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/rbs_luxI", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000139" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "rbs" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "rbs_luxI" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "RBS" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/rbs_luxR", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000139" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "rbs" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "rbs_luxR" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "RBS" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/ter_gfp", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000141" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "gfp terminator" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ter_gfp" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Terminator" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/ter_luxI", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000141" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "luxI terminator" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ter_luxI" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Terminator" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/ter_luxR", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000141" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "luxR terminator" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ter_luxR" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Terminator" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000645"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent3","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/luxR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent2"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference2"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/AHL"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/Constraint1","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#verifyIdentical"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint1"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent2"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference1"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/gfp","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#name":[{"@value":"gfp"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"gfp"}],"http://sbols.org/v3#description":[{"@value":"gfp coding sequence"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent12","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/LuxR_AHL"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent12"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LuxR_AHL","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#name":[{"@value":"LuxR_AHL"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"LuxR_AHL"}],"http://sbols.org/v3#description":[{"@value":"LuxR_AHL complex"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent4","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/ter_luxR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent4"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/ter_luxR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#name":[{"@value":"luxR terminator"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"ter_luxR"}],"http://sbols.org/v3#description":[{"@value":"Terminator"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/AHL"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/AHL","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000247"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/CHEBI:35224"}],"http://sbols.org/v3#name":[{"@value":"AHL"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"AHL"}],"http://sbols.org/v3#description":[{"@value":"AHL"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000010"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent9"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent9","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/AHL"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent9"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/GFP_protein","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#name":[{"@value":"GFP"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"GFP_protein"}],"http://sbols.org/v3#description":[{"@value":"GFP"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/Constraint2","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#contains"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint2"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/OrganismB"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent3","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/AHL_receiver"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/SenderSystem/Constraint3","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/SenderSystem/ComponentReference1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#verifyIdentical"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint3"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/SenderSystem/ComponentReference1","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent5"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference1"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/MulticellularSystem","http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2"},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/SubComponent2"},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/SubComponent1"},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#name":[{"@value":"MulticellularSystem"}],"http://sbols.org/v3#description":[{"@value":"Multicellular System"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000289"}],"http://sbols.org/v3#displayId":[{"@value":"MulticellularSystem"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#hasConstraint":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/Constraint1"}]},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/SenderSystem"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/AHL_producer/Interaction1","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation1"},{"@id":"https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction1"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000645"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent5"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/rbs_gfp","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000139"}],"http://sbols.org/v3#name":[{"@value":"rbs"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"rbs_gfp"}],"http://sbols.org/v3#description":[{"@value":"RBS"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000645"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent7"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent7","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/gfp"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent7"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent9"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference1"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent6","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/rbs_gfp"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent6"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent2","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/rbs_luxI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/rbs_luxI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000139"}],"http://sbols.org/v3#name":[{"@value":"rbs"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"rbs_luxI"}],"http://sbols.org/v3#description":[{"@value":"RBS"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/luxI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#name":[{"@value":"luxI"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"luxI"}],"http://sbols.org/v3#description":[{"@value":"luxI coding sequence"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/OrganismB","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/GO:0005623"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000290"}],"http://sbols.org/v3#name":[{"@value":"OrganismB"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"OrganismB"}],"http://sbols.org/v3#description":[{"@value":"Organism B"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/pConstLuxR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/pConstLuxR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000167"}],"http://sbols.org/v3#name":[{"@value":"pLuxR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"pConstLuxR"}],"http://sbols.org/v3#description":[{"@value":"Constituve promoter"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000643"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent5"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent5","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/pLuxR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent5"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction2","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction2"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent11"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent8","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/ter_gfp"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent8"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/ter_gfp","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#name":[{"@value":"gfp terminator"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"ter_gfp"}],"http://sbols.org/v3#description":[{"@value":"Terminator"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent4","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/ter_luxI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent4"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/ter_luxI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#name":[{"@value":"luxI terminator"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"ter_luxI"}],"http://sbols.org/v3#description":[{"@value":"Terminator"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/ReceiverSystem","http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent3"},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent1"},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1"},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent2"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#hasConstraint":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/Constraint1"},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/Constraint2"},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/Constraint3"}],"http://sbols.org/v3#displayId":[{"@value":"ReceiverSystem"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000289"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#description":[{"@value":"Receiver System"}],"http://sbols.org/v3#name":[{"@value":"ReceiverSystem"}]},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/Constraint1","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#contains"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint1"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/Constraint3","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#verifyIdentical"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint3"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver","http://sbols.org/v3#name":[{"@value":"AHL receiver"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent12"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent6"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent9"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent2"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent7"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent3"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent4"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent5"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent10"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent11"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent1"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent8"}],"http://sbols.org/v3#description":[{"@value":"AHL receiver"}],"http://sbols.org/v3#hasInteraction":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction1"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction3"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction2"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction4"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"AHL_receiver"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}]},{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent5","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/AHL"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent5"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/luxR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#name":[{"@value":"luxR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"luxR"}],"http://sbols.org/v3#description":[{"@value":"luxR coding sequence"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent11","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/GFP_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent11"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LuxR_protein","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#name":[{"@value":"LuxR_protein"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"LuxR_protein"}],"http://sbols.org/v3#description":[{"@value":"LuxR"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/OrganismA"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/OrganismA","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/GO:0005623"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000290"}],"http://sbols.org/v3#name":[{"@value":"OrganismA"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"OrganismA"}],"http://sbols.org/v3#description":[{"@value":"Organism A"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent2","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/rbs_luxR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction1","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction1"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction3","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000170"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction3"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction4","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000177"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2"},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction4"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent10","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/LuxR_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent10"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000010"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent10"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/pConstLuxI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000167"}],"http://sbols.org/v3#name":[{"@value":"pConstLuxI"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"pConstLuxI"}],"http://sbols.org/v3#description":[{"@value":"Constitutive promoter"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent12"}],"http://sbols.org/v3#displayId":[{"@value":"Participation3"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/SenderSystem/Constraint2","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#contains"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint2"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent3","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/AHL_producer"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent10"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/pConstLuxI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/pLuxR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000167"}],"http://sbols.org/v3#name":[{"@value":"pLuxR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"pLuxR"}],"http://sbols.org/v3#description":[{"@value":"LuxR inducible promoter"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/AHL_producer","http://sbols.org/v3#hasInteraction":[{"@id":"https://sbolstandard.org/examples/AHL_producer/Interaction1"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent4"},{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent5"},{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent1"},{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent2"},{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent3"}],"http://sbols.org/v3#name":[{"@value":"AHL producer"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#description":[{"@value":"AHL producer"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#displayId":[{"@value":"AHL_producer"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}]},{"@id":"https://sbolstandard.org/examples/SenderSystem","http://sbols.org/v3#description":[{"@value":"Sender System"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000289"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent2"},{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent3"},{"@id":"https://sbolstandard.org/examples/SenderSystem/ComponentReference1"},{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent1"}],"http://sbols.org/v3#hasConstraint":[{"@id":"https://sbolstandard.org/examples/SenderSystem/Constraint3"},{"@id":"https://sbolstandard.org/examples/SenderSystem/Constraint2"},{"@id":"https://sbolstandard.org/examples/SenderSystem/Constraint1"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"SenderSystem"}],"http://sbols.org/v3#name":[{"@value":"SenderSystem"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/SenderSystem/Constraint1","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#contains"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint1"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/AHL_producer/SubComponent3","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/luxI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/rbs_luxR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000139"}],"http://sbols.org/v3#name":[{"@value":"rbs"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"rbs_luxR"}],"http://sbols.org/v3#description":[{"@value":"RBS"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000459"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/AHL_receiver/SubComponent12"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]}]} \ No newline at end of file diff --git a/SBOL3/multicellular/multicellular.nt b/SBOL3/multicellular/multicellular.nt index 2f10e4e..a301557 100644 --- a/SBOL3/multicellular/multicellular.nt +++ b/SBOL3/multicellular/multicellular.nt @@ -1,91 +1,72 @@ - . - . - "rbs" . - . - "rbs_luxR" . - "RBS" . - . - . - "SubComponent2" . - . - . - . - . - "Interaction2" . - . - . - . - "Participation2" . - . + . + . + "Participation1" . + . . . "ComponentReference2" . . - . - . - "Participation2" . - . - . - . - "Participation2" . - . + . + . + . + "Constraint1" . + . + . + . + "gfp" . + . + "gfp" . + "gfp coding sequence" . + . + . + "SubComponent12" . + . + . + . + "SubComponent4" . + . + . + . + "LuxR_AHL" . + . + "LuxR_AHL" . + "LuxR_AHL complex" . + . + . + "SubComponent2" . + . . . "Participation2" . . + . + "GFP" . + . + "GFP_protein" . + "GFP" . + . + . + . + . + "Constraint2" . + . + . + . + . + "Constraint3" . + . . - . . + . + . + "MulticellularSystem" . "Multicellular System" . - . - . . - "MulticellularSystem" . + "MulticellularSystem" . . + . + . . - . - "MulticellularSystem" . - . - . - "Sender System" . - . - "SenderSystem" . - . - "SenderSystem" . - . - . - . - . - . - . - . - . - . - . - "Constraint1" . - . - . - . - . - "Constraint1" . - . - . - "SubComponent3" . - . - . - . - "SubComponent5" . - . - . - . - "gfp terminator" . - . - "ter_gfp" . - "Terminator" . - . - . - "SubComponent1" . - . . . . @@ -98,94 +79,102 @@ "rbs_gfp" . "RBS" . . - . - . - "SubComponent1" . - . - . - . - "luxR" . - . - "luxR" . - "luxR coding sequence" . - . + . + . + "Participation1" . + . + . + . + "ComponentReference1" . + . + . + . + "SubComponent6" . + . + . + . + "SubComponent2" . + . + . + . + "luxI" . + . + "luxI" . + "luxI coding sequence" . + . + . + "SubComponent1" . + . + . + . + "SubComponent1" . + . . . "Participation1" . . - . - . - "pLuxR" . - . - "pConstLuxR" . - "Constituve promoter" . - . + . + . + . + "Interaction2" . + . + . + . + "SubComponent8" . + . + . + . + "SubComponent4" . + . + . + . + . + . + . + "ReceiverSystem" . + . + . + . + . + "Receiver System" . + "ReceiverSystem" . + . + . . . "ComponentReference1" . . - . - . - . - "Interaction1" . - . - . - . - . - . - "AHL receiver" . - . - . - . - . - . - . - . - . - "AHL_receiver" . - . - . - . - . - . - . - . - "AHL receiver" . - . - . - . - "Participation1" . - . - . - . - "Participation1" . - . - . - "SubComponent1" . - . - . - . - "Participation1" . - . - . - . - . - "Constraint3" . - . - . - . - "luxR terminator" . - . - "ter_luxR" . - "Terminator" . - . - . - "SubComponent2" . - . - . - . - "SubComponent4" . - . + . + "SubComponent3" . + . + . + "SubComponent2" . + . + . + . + "Participation2" . + . + . + . + "AHL" . + . + "AHL" . + "AHL" . + . + . + . + "SubComponent3" . + . + . + "SubComponent11" . + . + . + . + "LuxR_protein" . + . + "LuxR_protein" . + "LuxR" . + . . . "OrganismB" . @@ -193,63 +182,74 @@ "OrganismB" . "Organism B" . . - . - "SubComponent9" . - . - . - . - . - "Constraint2" . - . - . - "SubComponent5" . - . . "SubComponent1" . . - . - . - "LuxR_protein" . - . - "LuxR_protein" . - "LuxR" . - . - . - . - "Participation2" . - . - . - . - "SubComponent3" . - . - . - . - "gfp" . - . - "gfp" . - "gfp coding sequence" . - . - . - "Receiver System" . - . - "ReceiverSystem" . - . - . - . - "ReceiverSystem" . - . - . - . - . - . - . - . - . - "LuxR_AHL" . - . - "LuxR_AHL" . - "LuxR_AHL complex" . - . + . + . + "luxR" . + . + "luxR" . + "luxR coding sequence" . + . + "AHL receiver" . + . + . + . + . + . + "AHL receiver" . + . + . + . + . + . + "AHL_receiver" . + . + . + . + . + . + . + . + . + . + . + . + . + "Participation1" . + . + . + . + "pConstLuxI" . + . + "pConstLuxI" . + "Constitutive promoter" . + . + . + . + . + . + "Interaction4" . + . + . + . + . + "Constraint1" . + . + . + . + . + "Constraint2" . + . + . + . + "ComponentReference1" . + . + . + . + "Participation2" . + . . . "rbs" . @@ -257,29 +257,37 @@ "rbs_luxI" . "RBS" . . - . - "SubComponent12" . - . - . - . - "OrganismA" . - . - "OrganismA" . - "Organism A" . - . - . - . - "SubComponent8" . - . - . - . - . - "Constraint1" . - . - . - . - "SubComponent4" . - . + . + . + "luxI terminator" . + . + "ter_luxI" . + "Terminator" . + . + . + . + "SubComponent1" . + . + . + . + "SubComponent5" . + . + . + "SubComponent3" . + . + . + . + "Participation3" . + . + . + . + . + "Constraint3" . + . + . + . + "Participation2" . + . . . "pLuxR" . @@ -287,123 +295,115 @@ "pLuxR" . "LuxR inducible promoter" . . + "Sender System" . + . + . + . + . + . + . + . + . + . + "SenderSystem" . + "SenderSystem" . + . + . + . + . + . + "Interaction1" . + . + . + . + "pLuxR" . + . + "pConstLuxR" . + "Constituve promoter" . + . + . + . + "SubComponent3" . + . + . + . + "SubComponent7" . + . + . + . + . + "AHL producer" . + . + . + "AHL producer" . + . + . + . + "AHL_producer" . + . + . + . + "SubComponent2" . + . + . + "SubComponent1" . + . . . "Participation1" . . + . + . + "rbs" . + . + "rbs_luxR" . + "RBS" . + . . . "SubComponent2" . . - . - . - . - . - "Interaction4" . - . - . - "GFP" . - . - "GFP_protein" . - "GFP" . - . - . - . - "luxI" . - . - "luxI" . - "luxI coding sequence" . - . - . - . - . - "Constraint3" . - . - . - "SubComponent11" . - . - . - "AHL producer" . - . - "AHL_producer" . - . - . - . - . - . - . - . - . - "AHL producer" . - . - . - "SubComponent7" . - . - . - . - "AHL" . - . - "AHL" . - "AHL" . - . - . - . - "SubComponent3" . - . - . - . - "pConstLuxI" . - . - "pConstLuxI" . - "Constitutive promoter" . - . - . - . - "SubComponent1" . - . - . - . - "luxI terminator" . - . - "ter_luxI" . - "Terminator" . - . + . + "SubComponent10" . + . + . + . + "luxR terminator" . + . + "ter_luxR" . + "Terminator" . + . + . + . + "OrganismA" . + . + "OrganismA" . + "Organism A" . + . + . + . + "gfp terminator" . + . + "ter_gfp" . + "Terminator" . + . + . + . + "Participation2" . + . . . . "Interaction3" . . - . - "SubComponent3" . - . - . - . - "Participation3" . - . - . - . - "ComponentReference1" . - . - . - . - "ComponentReference1" . - . - . - . - . - "Constraint2" . - . - . - "SubComponent10" . - . - . - . - "SubComponent6" . - . - . - "SubComponent2" . - . - . - . - "SubComponent2" . - . + . + . + . + "Constraint1" . + . + . + "SubComponent5" . + . + . + "SubComponent9" . + . diff --git a/SBOL3/multicellular/multicellular.rdf b/SBOL3/multicellular/multicellular.rdf index 583b7cc..58bee9c 100644 --- a/SBOL3/multicellular/multicellular.rdf +++ b/SBOL3/multicellular/multicellular.rdf @@ -10,73 +10,91 @@ xmlns="https://sbolstandard.org/examples/" xmlns:om="http://www.ontology-of-units-of-measure.org/resource/om-2/" xml:base="https://sbolstandard.org/examples/"> - + + + + LuxR_protein + + LuxR_protein + LuxR + + + Sender System + - - - - - - - SubComponent2 - - - - - - - - SubComponent2 - - - ComponentReference2 - + + + + + SubComponent2 + - - - Multicellular System - + - + - + - SubComponent2 + SubComponent5 - + - + - SubComponent1 + SubComponent3 ComponentReference1 - + + Constraint3 + + + + + + + + + + + + SubComponent1 + + + + + Constraint2 + + + + + + + + Constraint1 - - MulticellularSystem - - - - MulticellularSystem + + SenderSystem + SenderSystem + - - - - luxI + + + + AHL - luxI - luxI coding sequence + AHL + AHL @@ -86,6 +104,22 @@ rbs_luxI RBS + + + + pLuxR + + pLuxR + LuxR inducible promoter + + + + + luxI terminator + + ter_luxI + Terminator + GFP @@ -93,21 +127,87 @@ GFP_protein GFP - - - - LuxR_AHL + + + + luxR - LuxR_AHL - LuxR_AHL complex + luxR + luxR coding sequence - + + + + + + + SubComponent3 + + + + + + + + SubComponent1 + + + + + + + + + + + + SubComponent2 + + + Constraint1 + + + ReceiverSystem + + + + + + + SubComponent9 + + + + ComponentReference1 + + + + + + + + Constraint2 + + + Receiver System + ReceiverSystem + + + + + + Constraint3 + + + + + - - rbs + + luxI - rbs_gfp - RBS + luxI + luxI coding sequence @@ -117,123 +217,134 @@ ter_gfp Terminator - - - - OrganismA + + + + rbs - OrganismA - Organism A + rbs_gfp + RBS + + + + + gfp + + gfp + gfp coding sequence + + + + + pLuxR + + pConstLuxR + Constituve promoter + AHL receiver + + + + + + SubComponent12 + + + + + + + SubComponent6 + + + + + + + + + + SubComponent2 + + + + + + + SubComponent7 + + + AHL receiver - - + + - - + + - - - - - SubComponent10 + + + + SubComponent3 Participation1 - - - - - - - - SubComponent9 - - - Participation2 - - - - + - - - SubComponent12 + + + SubComponent10 - Participation3 + Participation2 - Interaction4 + Interaction1 - - - - SubComponent11 - - - + + - - + + - - + + - + - - - - SubComponent3 + + SubComponent5 Participation1 - - - + + + Participation2 - Interaction1 + Interaction3 - AHL receiver - - - - - - SubComponent5 - - - - - + - + - SubComponent7 - - - - - - - SubComponent6 + SubComponent4 + AHL_receiver @@ -247,197 +358,109 @@ - + + + + SubComponent11 + + Participation2 Interaction2 - - - - - SubComponent8 - - - - AHL_receiver - - - - - - - - SubComponent1 - - - - - - - - - - - SubComponent2 - - - - - - - - - - SubComponent4 - - - AHL receiver - - + + - - - + + + Participation1 - - - - Participation2 - - - Interaction3 - - - - - - - luxI terminator - - ter_luxI - Terminator - - - - - OrganismB - - OrganismB - Organism B - - - - Receiver System + + + + Participation2 + + + + + + + Participation3 + + + Interaction4 + + + + + + - - - SubComponent3 + + + + SubComponent1 - ReceiverSystem + - - - - ComponentReference1 - + + + + SubComponent8 + - - ReceiverSystem - - - - - - Constraint3 - - - - - - - - - SubComponent1 - - - - - Constraint1 - - - - - - - - - Constraint2 - - - - + - - pLuxR + + luxR terminator - pConstLuxR - Constituve promoter + ter_luxR + Terminator - - AHL producer - - - - - SubComponent3 - - - AHL_producer - - - - - SubComponent2 - - - + + + + + SubComponent3 + + Participation1 - - - - - - SubComponent5 - - + Participation2 Interaction1 - + + + + + SubComponent4 + + + + AHL producer @@ -447,108 +470,85 @@ SubComponent1 + + AHL producer - + - - SubComponent4 + + SubComponent2 - + + AHL_producer + - AHL producer - + + + + LuxR_AHL + LuxR_AHL + LuxR_AHL complex + + + + + OrganismA + + OrganismA + Organism A + + + + + + + + + SubComponent2 + + + ComponentReference2 + + + + + + MulticellularSystem + Multicellular System + + MulticellularSystem - - + + SubComponent1 - Sender System - - - - - - Constraint1 - - - SenderSystem - + - - - - - - SubComponent3 - - + + + ComponentReference1 - - Constraint3 - - - SenderSystem - - - - - - - Constraint2 + + Constraint1 - - - - - - - - - luxR terminator - - ter_luxR - Terminator - - - - - AHL - - AHL - AHL - - - - - pConstLuxI - - pConstLuxI - Constitutive promoter - - - - - pLuxR - - pLuxR - LuxR inducible promoter + - - - - luxR + + + + OrganismB - luxR - luxR coding sequence + OrganismB + Organism B @@ -558,20 +558,12 @@ rbs_luxR RBS - - - - LuxR_protein - - LuxR_protein - LuxR - - + - - gfp + + pConstLuxI - gfp - gfp coding sequence + pConstLuxI + Constitutive promoter diff --git a/SBOL3/multicellular/multicellular.rj b/SBOL3/multicellular/multicellular.rj index 28ce1d7..edec4e2 100644 --- a/SBOL3/multicellular/multicellular.rj +++ b/SBOL3/multicellular/multicellular.rj @@ -1,70 +1,51 @@ { - "https://sbolstandard.org/examples/MulticellularSystem" : { + "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "MulticellularSystem" + "value" : "Participation2" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000289" + "value" : "https://identifiers.org/SBO:0000011" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "http://sbols.org/v3#Participation" } - ] , - "http://sbols.org/v3#hasConstraint" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" + ] + } + , + "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation2" } ] , - "http://sbols.org/v3#hasFeature" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" - } - , { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "MulticellularSystem" + "value" : "https://identifiers.org/SBO:0000011" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Multicellular System" + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" - } - ] , + "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "Participation1" @@ -75,6 +56,11 @@ "value" : "https://identifiers.org/SBO:0000645" } ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" + } + ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Participation" @@ -82,84 +68,66 @@ ] } , - "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" : { + "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "Constraint1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" } ] , - "http://sbols.org/v3#instanceOf" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem" - } - ] - } - , - "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2" : { - "http://sbols.org/v3#participant" : [ { + "http://sbols.org/v3#restriction" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" - } - ] , - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "Participation2" + "value" : "http://sbols.org/v3#verifyIdentical" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#object" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000459" + "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Constraint" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/SubComponent6" : { + "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent6" + "value" : "Participation1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000645" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent3" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/rbs_gfp" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/OrganismA" : { + "https://sbolstandard.org/examples/ter_gfp" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "OrganismA" + "value" : "ter_gfp" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000290" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000141" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -167,83 +135,37 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "OrganismA" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "Organism A" + "value" : "Terminator" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/GO:0005623" - } - ] - } - , - "https://sbolstandard.org/examples/AHL_receiver/SubComponent2" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "SubComponent2" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" - } - ] , - "http://sbols.org/v3#orientation" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#instanceOf" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/rbs_luxR" - } - ] - } - , - "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" : { - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "ComponentReference2" + "value" : "gfp terminator" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" - } - ] , - "http://sbols.org/v3#inChildOf" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" - } - ] , - "http://sbols.org/v3#refersTo" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/pConstLuxR" : { + "https://sbolstandard.org/examples/rbs_gfp" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "pConstLuxR" + "value" : "rbs_gfp" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000167" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000139" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -251,206 +173,164 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "pLuxR" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "Constituve promoter" + "value" : "RBS" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" - } - ] - } - , - "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation2" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5" } ] , - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Participation2" - } - ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000011" + "value" : "rbs" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" : { + "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent12" + "value" : "ComponentReference1" + } + ] , + "http://sbols.org/v3#inChildOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "http://sbols.org/v3#ComponentReference" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#refersTo" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LuxR_AHL" + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" } ] } , - "https://sbolstandard.org/examples/AHL_producer" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "AHL_producer" - } - ] , - "http://sbols.org/v3#role" : [ { + "https://sbolstandard.org/examples/AHL_receiver" : { + "http://sbols.org/v3#hasFeature" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000704" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + , { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent8" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" } - ] , - "http://sbols.org/v3#hasFeature" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent3" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent2" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent2" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent1" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent1" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent4" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent6" } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "AHL producer" + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "AHL producer" + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" } - ] , - "http://sbols.org/v3#hasInteraction" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_producer/Interaction1" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" } - ] , - "http://sbols.org/v3#type" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent4" } - ] - } - , - "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" : { + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent3" + "value" : "AHL_receiver" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SO:0000704" } ] , - "http://sbols.org/v3#instanceOf" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver" - } - ] - } - , - "https://sbolstandard.org/examples/AHL_producer/SubComponent2" : { - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "AHL receiver" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#hasInteraction" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/rbs_luxI" + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2" } - ] - } - , - "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3" : { - "http://sbols.org/v3#participant" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1" } - ] , - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "Participation3" + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4" } - ] , - "http://sbols.org/v3#role" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000011" + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "AHL receiver" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/pLuxR" : { + "https://sbolstandard.org/examples/ter_luxR" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "pLuxR" + "value" : "ter_luxR" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000167" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000141" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -458,83 +338,77 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "pLuxR" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "LuxR inducible promoter" + "value" : "Terminator" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" } - ] - } - , - "https://sbolstandard.org/examples/SenderSystem/SubComponent3" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "SubComponent3" + "value" : "luxR terminator" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" - } - ] , - "http://sbols.org/v3#instanceOf" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_producer" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/ReceiverSystem/Constraint3" : { + "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Constraint3" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" + "value" : "Participation1" } ] , - "http://sbols.org/v3#subject" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" + "value" : "https://identifiers.org/SBO:0000643" } ] , - "http://sbols.org/v3#restriction" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#verifyIdentical" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" } ] , - "http://sbols.org/v3#object" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/luxI" : { + "https://sbolstandard.org/examples/MulticellularSystem" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "luxI" + "value" : "MulticellularSystem" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000316" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SBO:0000289" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -542,60 +416,79 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "luxI" + "value" : "Multicellular System" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "luxI coding sequence" + "http://sbols.org/v3#hasConstraint" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "https://identifiers.org/SBO:0000241" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "MulticellularSystem" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" : { + "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent9" + "value" : "Participation2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000459" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" : { + "https://sbolstandard.org/examples/AHL_receiver/Interaction2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent5" + "value" : "Interaction2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000589" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/pLuxR" + "value" : "http://sbols.org/v3#Interaction" } ] } @@ -606,64 +499,105 @@ "value" : "Interaction1" } ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000589" + } + ] , "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1" + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2" + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Interaction" - } - ] , - "http://sbols.org/v3#type" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000589" } ] } , - "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" : { + "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ComponentReference1" + "value" : "SubComponent9" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" + "value" : "https://sbolstandard.org/examples/AHL" } ] , - "http://sbols.org/v3#inChildOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/AHL_receiver/SubComponent8" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#refersTo" : [ { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent8" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + "value" : "https://sbolstandard.org/examples/ter_gfp" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/ter_luxI" : { + "https://sbolstandard.org/examples/SenderSystem/Constraint1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ter_luxI" + "value" : "Constraint1" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000141" + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + } + ] , + "http://sbols.org/v3#restriction" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#contains" + } + ] , + "http://sbols.org/v3#object" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#Constraint" + } + ] + } + , + "https://sbolstandard.org/examples/AHL" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "AHL" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/CHEBI:35224" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -671,283 +605,302 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "luxI terminator" + "value" : "AHL" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000247" + } + ] , + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Terminator" + "value" : "AHL" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/SubComponent1" : { + "https://sbolstandard.org/examples/SenderSystem/Constraint2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent1" + "value" : "Constraint2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#restriction" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "http://sbols.org/v3#contains" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#object" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/pConstLuxR" + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Constraint" } ] } , - "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation1" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent3" - } - ] , + "https://sbolstandard.org/examples/SenderSystem/SubComponent3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation1" + "value" : "SubComponent3" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000645" + "value" : "https://sbolstandard.org/examples/AHL_producer" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" : { + "https://sbolstandard.org/examples/SenderSystem/SubComponent2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent11" + "value" : "SubComponent2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/AHL" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/GFP_protein" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/ReceiverSystem" : { + "https://sbolstandard.org/examples/SenderSystem/Constraint3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ReceiverSystem" + "value" : "Constraint3" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000289" + "value" : "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#restriction" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#verifyIdentical" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#object" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" } ] , - "http://sbols.org/v3#hasConstraint" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" - } - , { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint3" + "value" : "http://sbols.org/v3#Constraint" } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint2" + ] + } + , + "https://sbolstandard.org/examples/SenderSystem/SubComponent1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" } ] , - "http://sbols.org/v3#hasFeature" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - } - , { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" + "value" : "https://sbolstandard.org/examples/OrganismA" } - , { + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" + "value" : "http://sbols.org/v3#SubComponent" } - , { + ] + } + , + "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ReceiverSystem" + "value" : "SubComponent3" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Receiver System" + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/luxR" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/Interaction2" : { + "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interaction2" + "value" : "ComponentReference2" } ] , - "http://sbols.org/v3#hasParticipation" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2" - } - , { + "http://sbols.org/v3#inChildOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1" + "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Interaction" + "value" : "http://sbols.org/v3#ComponentReference" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#refersTo" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000589" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" } ] } , - "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" : { + "https://sbolstandard.org/examples/AHL_receiver/SubComponent2" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "SubComponent2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/rbs_luxR" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/AHL_producer/SubComponent1" : { + "https://sbolstandard.org/examples/AHL_receiver/SubComponent1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "SubComponent1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" - } - ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples/pConstLuxR" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/pConstLuxI" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation2" : { - "http://sbols.org/v3#participant" : [ { + "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" + "value" : "https://identifiers.org/SO:0001030" } ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation2" + "value" : "SubComponent7" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000011" + "value" : "https://sbolstandard.org/examples/gfp" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2" : { - "http://sbols.org/v3#participant" : [ { + "https://sbolstandard.org/examples/AHL_receiver/SubComponent6" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" + "value" : "https://identifiers.org/SO:0001030" } ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation2" + "value" : "SubComponent6" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000010" + "value" : "https://sbolstandard.org/examples/rbs_gfp" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/ter_luxR" : { + "https://sbolstandard.org/examples/ReceiverSystem" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ter_luxR" + "value" : "ReceiverSystem" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000141" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SBO:0000289" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -955,121 +908,127 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "luxR terminator" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "Terminator" + "value" : "Receiver System" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#hasConstraint" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" - } - ] - } - , - "https://sbolstandard.org/examples/AHL" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "AHL" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint3" } - ] , - "http://sbols.org/v3#role" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/CHEBI:35224" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint2" } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + , { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://identifiers.org/SBO:0000241" } ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "AHL" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "AHL" + "value" : "ReceiverSystem" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000247" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/pConstLuxI" : { + "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "pConstLuxI" + "value" : "SubComponent2" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000167" + "value" : "https://sbolstandard.org/examples/ReceiverSystem" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#SubComponent" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + ] + } + , + "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "pConstLuxI" + "value" : "SubComponent5" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Constitutive promoter" + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/pLuxR" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/AHL_producer/SubComponent5" : { + "https://sbolstandard.org/examples/AHL_receiver/SubComponent4" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent5" + "value" : "SubComponent4" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/ter_luxR" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" } ] , "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL" + "value" : "https://sbolstandard.org/examples/SenderSystem" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/luxR" : { + "https://sbolstandard.org/examples/gfp" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "luxR" + "value" : "gfp" } ] , "http://sbols.org/v3#role" : [ { @@ -1077,103 +1036,113 @@ "value" : "https://identifiers.org/SO:0000316" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" - } - ] , "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "luxR" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "luxR coding sequence" + "value" : "gfp coding sequence" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "gfp" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/SenderSystem/SubComponent2" : { + "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "ComponentReference1" + } + ] , + "http://sbols.org/v3#inChildOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "http://sbols.org/v3#ComponentReference" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#refersTo" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL" + "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5" } ] } , - "https://sbolstandard.org/examples/SenderSystem/Constraint1" : { + "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Constraint1" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" + "value" : "ComponentReference1" } ] , - "http://sbols.org/v3#subject" : [ { + "http://sbols.org/v3#inChildOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" } ] , - "http://sbols.org/v3#restriction" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#contains" + "value" : "http://sbols.org/v3#ComponentReference" } ] , - "http://sbols.org/v3#object" : [ { + "http://sbols.org/v3#refersTo" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" } ] } , - "https://sbolstandard.org/examples/ReceiverSystem/Constraint2" : { + "https://sbolstandard.org/examples/LuxR_protein" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Constraint2" + "value" : "LuxR_protein" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" + "value" : "https://identifiers.org/GO:0003700" } ] , - "http://sbols.org/v3#subject" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#restriction" : [ { + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "LuxR" + } + ] , + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#contains" + "value" : "https://identifiers.org/SBO:0000252" } ] , - "http://sbols.org/v3#object" : [ { + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "LuxR_protein" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" + "value" : "http://sbols.org/v3#Component" } ] } @@ -1189,21 +1158,11 @@ "value" : "https://identifiers.org/SO:0000139" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" - } - ] , "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "rbs" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , "value" : "RBS" @@ -1213,102 +1172,101 @@ "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" } - ] + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "rbs" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] } , - "https://sbolstandard.org/examples/AHL_receiver/SubComponent8" : { + "https://sbolstandard.org/examples/AHL_producer/Interaction1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent8" + "value" : "Interaction1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000589" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation1" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ter_gfp" + "value" : "http://sbols.org/v3#Interaction" } ] } , - "https://sbolstandard.org/examples/GFP_protein" : { + "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "GFP_protein" + "value" : "Participation1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SBO:0000645" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "GFP" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "GFP" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/SubComponent4" : { + "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent4" + "value" : "Participation2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000011" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ter_luxR" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/rbs_gfp" : { + "https://sbolstandard.org/examples/luxI" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "rbs_gfp" + "value" : "luxI" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000139" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000316" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -1316,410 +1274,365 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "rbs" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "RBS" + "value" : "luxI coding sequence" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" - } - ] - } - , - "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" } ] , - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Participation1" - } - ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000010" + "value" : "luxI" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" : { + "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Constraint1" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" - } - ] , - "http://sbols.org/v3#subject" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" - } - ] , - "http://sbols.org/v3#restriction" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#contains" + "value" : "SubComponent1" } ] , - "http://sbols.org/v3#object" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - } - ] - } - , - "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "SubComponent10" + "value" : "https://sbolstandard.org/examples/OrganismB" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#SubComponent" - } - ] , - "http://sbols.org/v3#instanceOf" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LuxR_protein" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/Interaction3" : { + "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interaction3" + "value" : "SubComponent2" } ] , - "http://sbols.org/v3#hasParticipation" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1" - } - , { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2" + "value" : "https://sbolstandard.org/examples/AHL" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Interaction" - } - ] , - "http://sbols.org/v3#type" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000170" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/SenderSystem" : { + "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SenderSystem" + "value" : "SubComponent3" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000289" + "value" : "https://sbolstandard.org/examples/AHL_receiver" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" - } - ] , - "http://sbols.org/v3#hasNamespace" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , - "http://sbols.org/v3#hasConstraint" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/Constraint3" + "value" : "http://sbols.org/v3#SubComponent" } - , { + ] + } + , + "https://sbolstandard.org/examples/AHL_producer" : { + "http://sbols.org/v3#hasFeature" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/Constraint2" + "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/Constraint1" - } - ] , - "http://sbols.org/v3#hasFeature" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" + "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent4" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3" + "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent3" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent2" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent1" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SenderSystem" + "value" : "AHL_producer" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" } ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "Sender System" + "value" : "AHL producer" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "https://sbolstandard.org/examples" } - ] - } - , - "https://sbolstandard.org/examples/AHL_receiver/Interaction1/Participation1" : { - "http://sbols.org/v3#participant" : [ { + ] , + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "Participation1" + "http://sbols.org/v3#hasInteraction" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/AHL_producer/Interaction1" } ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000645" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "AHL producer" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" : { + "https://sbolstandard.org/examples/LuxR_AHL" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ComponentReference1" + "value" : "LuxR_AHL" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" + "value" : "https://identifiers.org/GO:0003700" } ] , - "http://sbols.org/v3#inChildOf" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#refersTo" : [ { + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "LuxR_AHL complex" + } + ] , + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" + "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "LuxR_AHL" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/rbs_luxR" : { + "https://sbolstandard.org/examples/AHL_receiver/Interaction4" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "rbs_luxR" + "value" : "Interaction4" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000139" + "value" : "https://identifiers.org/SBO:0000177" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "rbs" + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1" } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "RBS" + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Interaction" } ] } , - "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" : { + "https://sbolstandard.org/examples/AHL_receiver/Interaction3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent1" + "value" : "Interaction3" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000170" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/OrganismB" + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Interaction" } ] } , - "https://sbolstandard.org/examples/AHL_producer/SubComponent4" : { + "https://sbolstandard.org/examples/ReceiverSystem/Constraint3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent4" + "value" : "Constraint3" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/ComponentReference1" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#restriction" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "http://sbols.org/v3#verifyIdentical" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#object" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ter_luxI" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Constraint" } ] } , - "https://sbolstandard.org/examples/LuxR_protein" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "LuxR_protein" + "https://sbolstandard.org/examples/SenderSystem" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3" } - ] , - "http://sbols.org/v3#role" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/GO:0003700" + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + , { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "LuxR_protein" + "value" : "SenderSystem" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000289" } ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "LuxR" + "value" : "Sender System" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" - } - ] - } - , - "https://sbolstandard.org/examples/SenderSystem/Constraint2" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "Constraint2" + "value" : "https://sbolstandard.org/examples" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasConstraint" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" + "value" : "https://sbolstandard.org/examples/SenderSystem/Constraint1" } - ] , - "http://sbols.org/v3#subject" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + "value" : "https://sbolstandard.org/examples/SenderSystem/Constraint2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/SenderSystem/Constraint3" } ] , - "http://sbols.org/v3#restriction" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#contains" + "value" : "https://identifiers.org/SBO:0000241" } ] , - "http://sbols.org/v3#object" : [ { + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "SenderSystem" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/SenderSystem/SubComponent1" : { + "https://sbolstandard.org/examples/AHL_producer/SubComponent5" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent1" + "value" : "SubComponent5" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/AHL" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/OrganismA" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/gfp" : { + "https://sbolstandard.org/examples/pLuxR" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "gfp" + "value" : "pLuxR" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000316" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000167" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -1727,507 +1640,594 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "gfp" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "gfp coding sequence" + "value" : "LuxR inducible promoter" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "pLuxR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/Interaction2/Participation2" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" - } - ] , + "https://sbolstandard.org/examples/ter_luxI" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation2" + "value" : "ter_luxI" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000011" + "value" : "https://identifiers.org/SO:0000141" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "https://sbolstandard.org/examples" } - ] - } - , - "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "SubComponent7" + "value" : "Terminator" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#orientation" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "luxI terminator" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/gfp" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/LuxR_AHL" : { + "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "LuxR_AHL" + "value" : "Participation3" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/GO:0003700" + "value" : "https://identifiers.org/SBO:0000011" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "http://sbols.org/v3#Participation" } - ] , - "http://sbols.org/v3#name" : [ { + ] + } + , + "https://sbolstandard.org/examples/GFP_protein" : { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "LuxR_AHL" + "value" : "GFP_protein" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" } ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "LuxR_AHL complex" + "value" : "GFP" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "GFP" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/Interaction3/Participation1" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" - } - ] , + "https://sbolstandard.org/examples/luxR" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation1" + "value" : "luxR" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000643" + "value" : "https://identifiers.org/SO:0000316" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "https://sbolstandard.org/examples" } - ] - } - , - "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "SubComponent3" + "value" : "luxR coding sequence" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#orientation" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "luxR" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/luxR" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/ter_gfp" : { + "https://sbolstandard.org/examples/ReceiverSystem/Constraint2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ter_gfp" + "value" : "Constraint2" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000141" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#restriction" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#contains" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#object" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "gfp terminator" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Terminator" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent3" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Constraint" } ] } , - "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" : { + "https://sbolstandard.org/examples/AHL_producer/SubComponent4" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent1" + "value" : "SubComponent4" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/ter_luxI" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" : { + "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "Constraint1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" - } - ] , "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" } ] , "http://sbols.org/v3#restriction" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#verifyIdentical" + "value" : "http://sbols.org/v3#contains" } ] , "http://sbols.org/v3#object" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Constraint" } ] } , - "https://sbolstandard.org/examples/AHL_receiver" : { + "https://sbolstandard.org/examples/AHL_producer/SubComponent3" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "AHL_receiver" + "value" : "SubComponent3" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000704" + "value" : "https://sbolstandard.org/examples/luxI" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#SubComponent" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + ] + } + , + "https://sbolstandard.org/examples/AHL_producer/SubComponent2" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#hasFeature" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent2" } - , { + ] , + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" + "value" : "https://sbolstandard.org/examples/rbs_luxI" } - , { + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" + "value" : "http://sbols.org/v3#SubComponent" } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent8" + ] + } + , + "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation1" } - , { + ] , + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent7" + "value" : "https://identifiers.org/SBO:0000010" } - , { + ] , + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" } - , { + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent4" + "value" : "http://sbols.org/v3#Participation" } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent3" + ] + } + , + "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation2" } - , { + ] , + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent6" + "value" : "https://identifiers.org/SBO:0000010" } - , { + ] , + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent5" + "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent9" } - , { + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent2" + "value" : "http://sbols.org/v3#Participation" } - , { + ] + } + , + "https://sbolstandard.org/examples/AHL_producer/SubComponent1" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/SubComponent1" + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "AHL receiver" + "value" : "SubComponent1" } ] , - "http://sbols.org/v3#hasInteraction" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4" + "value" : "https://sbolstandard.org/examples/pConstLuxI" } - , { + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction3" + "value" : "http://sbols.org/v3#SubComponent" } - , { + ] + } + , + "https://sbolstandard.org/examples/pConstLuxR" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "pConstLuxR" + } + ] , + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction2" + "value" : "https://identifiers.org/SO:0000167" } - , { + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction1" + "value" : "https://sbolstandard.org/examples" } ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "AHL receiver" + "value" : "Constituve promoter" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "pLuxR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/OrganismB" : { + "https://sbolstandard.org/examples/AHL_receiver/SubComponent10" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "OrganismB" + "value" : "SubComponent10" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000290" + "value" : "https://sbolstandard.org/examples/LuxR_protein" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/OrganismA" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "OrganismA" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://identifiers.org/SBO:0000290" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "OrganismB" + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" } ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "Organism B" + "value" : "Organism A" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/GO:0005623" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "OrganismA" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/AHL_producer/Interaction1" : { + "https://sbolstandard.org/examples/OrganismB" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interaction1" + "value" : "OrganismB" } ] , - "http://sbols.org/v3#hasParticipation" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation1" + "value" : "https://identifiers.org/SBO:0000290" } - , { + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_producer/Interaction1/Participation2" + "value" : "https://sbolstandard.org/examples" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Interaction" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Organism B" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000589" + "value" : "https://identifiers.org/GO:0005623" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "OrganismB" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/AHL_receiver/Interaction4" : { + "https://sbolstandard.org/examples/AHL_receiver/SubComponent11" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interaction4" + "value" : "SubComponent11" } ] , - "http://sbols.org/v3#hasParticipation" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation1" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation3" - } - , { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_receiver/Interaction4/Participation2" + "value" : "https://sbolstandard.org/examples/GFP_protein" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Interaction" - } - ] , - "http://sbols.org/v3#type" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000177" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/AHL_producer/SubComponent3" : { + "https://sbolstandard.org/examples/rbs_luxR" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent3" + "value" : "rbs_luxR" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SO:0000139" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "RBS" + } + ] , + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/luxI" + "value" : "https://identifiers.org/SBO:0000251" } - ] - } - , - "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "ComponentReference1" + "value" : "rbs" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/AHL_receiver/SubComponent12" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent12" } ] , - "http://sbols.org/v3#inChildOf" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent3" + "value" : "https://sbolstandard.org/examples/LuxR_AHL" } ] , - "http://sbols.org/v3#refersTo" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL_producer/SubComponent5" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/SenderSystem/Constraint3" : { + "https://sbolstandard.org/examples/pConstLuxI" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Constraint3" + "value" : "pConstLuxI" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" + "value" : "https://identifiers.org/SO:0000167" } ] , - "http://sbols.org/v3#subject" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/ComponentReference1" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#restriction" : [ { + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Constitutive promoter" + } + ] , + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#verifyIdentical" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#object" : [ { + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "pConstLuxI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + "value" : "http://sbols.org/v3#Component" } ] } diff --git a/SBOL3/multicellular/multicellular.ttl b/SBOL3/multicellular/multicellular.ttl index ca08577..f641f27 100644 --- a/SBOL3/multicellular/multicellular.ttl +++ b/SBOL3/multicellular/multicellular.ttl @@ -1,509 +1,509 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . - -:rbs_luxR a sbol:Component ; - sbol:description "RBS" ; - sbol:displayId "rbs_luxR" ; - sbol:hasNamespace ; - sbol:name "rbs" ; - sbol:role SO:0000139 ; - sbol:type SBO:0000251 . - - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :AHL . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: - - a sbol:Interaction ; - sbol:displayId "Interaction2" ; - sbol:hasParticipation , ; - sbol:type SBO:0000589 . - - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; - sbol:role SBO:0000011 . + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000645 . - a sbol:ComponentReference ; - sbol:displayId "ComponentReference2" ; - sbol:inChildOf ; + a sbol:ComponentReference; + sbol:displayId "ComponentReference2"; + sbol:inChildOf ; sbol:refersTo . - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; - sbol:role SBO:0000011 . + + a sbol:Constraint; + sbol:displayId "Constraint1"; + sbol:object ; + sbol:restriction sbol:verifyIdentical; + sbol:subject . - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; - sbol:role SBO:0000459 . +:gfp a sbol:Component; + sbol:description "gfp coding sequence"; + sbol:displayId "gfp"; + sbol:hasNamespace ; + sbol:name "gfp"; + sbol:role SO:0000316; + sbol:type SBO:0000251 . - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; - sbol:role SBO:0000010 . + + a sbol:SubComponent; + sbol:displayId "SubComponent12"; + sbol:instanceOf :LuxR_AHL . -:MulticellularSystem a sbol:Component ; - sbol:description "Multicellular System" ; - sbol:displayId "MulticellularSystem" ; - sbol:hasConstraint ; - sbol:hasFeature , , , ; - sbol:hasNamespace ; - sbol:name "MulticellularSystem" ; - sbol:role SBO:0000289 ; - sbol:type SBO:0000241 . + + a sbol:SubComponent; + sbol:displayId "SubComponent4"; + sbol:instanceOf :ter_luxR; + sbol:orientation SO:0001030 . -:SenderSystem a sbol:Component ; - sbol:description "Sender System" ; - sbol:displayId "SenderSystem" ; - sbol:hasConstraint , , ; - sbol:hasFeature , , , ; - sbol:hasNamespace ; - sbol:name "SenderSystem" ; - sbol:role SBO:0000289 ; - sbol:type SBO:0000241 . +:LuxR_AHL a sbol:Component; + sbol:description "LuxR_AHL complex"; + sbol:displayId "LuxR_AHL"; + sbol:hasNamespace ; + sbol:name "LuxR_AHL"; + sbol:role GO:0003700; + sbol:type SBO:0000252 . - - a sbol:Constraint ; - sbol:displayId "Constraint1" ; - sbol:object ; - sbol:restriction sbol:contains ; - sbol:subject . + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :AHL . - - a sbol:Constraint ; - sbol:displayId "Constraint1" ; - sbol:object ; - sbol:restriction sbol:verifyIdentical ; - sbol:subject . + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000010 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent3" ; - sbol:instanceOf :AHL_producer . +:GFP_protein a sbol:Component; + sbol:description "GFP"; + sbol:displayId "GFP_protein"; + sbol:hasNamespace ; + sbol:name "GFP"; + sbol:type SBO:0000252 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent5" ; - sbol:instanceOf :pLuxR ; - sbol:orientation SO:0001030 . + + a sbol:Constraint; + sbol:displayId "Constraint2"; + sbol:object ; + sbol:restriction sbol:contains; + sbol:subject . -:ter_gfp a sbol:Component ; - sbol:description "Terminator" ; - sbol:displayId "ter_gfp" ; - sbol:hasNamespace ; - sbol:name "gfp terminator" ; - sbol:role SO:0000141 ; - sbol:type SBO:0000251 . + + a sbol:Constraint; + sbol:displayId "Constraint3"; + sbol:object ; + sbol:restriction sbol:verifyIdentical; + sbol:subject . - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :SenderSystem . +:MulticellularSystem a sbol:Component; + sbol:description "Multicellular System"; + sbol:displayId "MulticellularSystem"; + sbol:hasConstraint ; + sbol:hasFeature , , , ; + sbol:hasNamespace ; + sbol:name "MulticellularSystem"; + sbol:role SBO:0000289; + sbol:type SBO:0000241 . - a sbol:Interaction ; - sbol:displayId "Interaction1" ; - sbol:hasParticipation , ; + a sbol:Interaction; + sbol:displayId "Interaction1"; + sbol:hasParticipation , ; sbol:type SBO:0000589 . -:rbs_gfp a sbol:Component ; - sbol:description "RBS" ; - sbol:displayId "rbs_gfp" ; - sbol:hasNamespace ; - sbol:name "rbs" ; - sbol:role SO:0000139 ; +:rbs_gfp a sbol:Component; + sbol:description "RBS"; + sbol:displayId "rbs_gfp"; + sbol:hasNamespace ; + sbol:name "rbs"; + sbol:role SO:0000139; sbol:type SBO:0000251 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :pConstLuxI ; + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000645 . + + + a sbol:ComponentReference; + sbol:displayId "ComponentReference1"; + sbol:inChildOf ; + sbol:refersTo . + + + a sbol:SubComponent; + sbol:displayId "SubComponent6"; + sbol:instanceOf :rbs_gfp; + sbol:orientation SO:0001030 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :rbs_luxI; sbol:orientation SO:0001030 . -:luxR a sbol:Component ; - sbol:description "luxR coding sequence" ; - sbol:displayId "luxR" ; - sbol:hasNamespace ; - sbol:name "luxR" ; - sbol:role SO:0000316 ; +:luxI a sbol:Component; + sbol:description "luxI coding sequence"; + sbol:displayId "luxI"; + sbol:hasNamespace ; + sbol:name "luxI"; + sbol:role SO:0000316; sbol:type SBO:0000251 . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000643 . + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :OrganismB . -:pConstLuxR a sbol:Component ; - sbol:description "Constituve promoter" ; - sbol:displayId "pConstLuxR" ; - sbol:hasNamespace ; - sbol:name "pLuxR" ; - sbol:role SO:0000167 ; - sbol:type SBO:0000251 . + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :pConstLuxR; + sbol:orientation SO:0001030 . - - a sbol:ComponentReference ; - sbol:displayId "ComponentReference1" ; - sbol:inChildOf ; - sbol:refersTo . + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000643 . - - a sbol:Interaction ; - sbol:displayId "Interaction1" ; - sbol:hasParticipation , ; + + a sbol:Interaction; + sbol:displayId "Interaction2"; + sbol:hasParticipation , ; sbol:type SBO:0000589 . -:AHL_receiver a sbol:Component ; - sbol:description "AHL receiver" ; - sbol:displayId "AHL_receiver" ; - sbol:hasFeature , , , , , , , , , , , ; - sbol:hasInteraction , , , ; - sbol:hasNamespace ; - sbol:name "AHL receiver" ; - sbol:role SO:0000704 ; - sbol:type SBO:0000251 . + + a sbol:SubComponent; + sbol:displayId "SubComponent8"; + sbol:instanceOf :ter_gfp; + sbol:orientation SO:0001030 . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000645 . + + a sbol:SubComponent; + sbol:displayId "SubComponent4"; + sbol:instanceOf :ter_luxI; + sbol:orientation SO:0001030 . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000645 . +:ReceiverSystem a sbol:Component; + sbol:description "Receiver System"; + sbol:displayId "ReceiverSystem"; + sbol:hasConstraint , , ; + sbol:hasFeature , , , ; + sbol:hasNamespace ; + sbol:name "ReceiverSystem"; + sbol:role SBO:0000289; + sbol:type SBO:0000241 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :OrganismB . + + a sbol:ComponentReference; + sbol:displayId "ComponentReference1"; + sbol:inChildOf ; + sbol:refersTo . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000010 . + + a sbol:SubComponent; + sbol:displayId "SubComponent3"; + sbol:instanceOf :AHL_receiver . - - a sbol:Constraint ; - sbol:displayId "Constraint3" ; - sbol:object ; - sbol:restriction sbol:verifyIdentical ; - sbol:subject . + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :ReceiverSystem . -:ter_luxR a sbol:Component ; - sbol:description "Terminator" ; - sbol:displayId "ter_luxR" ; - sbol:hasNamespace ; - sbol:name "luxR terminator" ; - sbol:role SO:0000141 ; - sbol:type SBO:0000251 . + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000011 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :AHL . +:AHL a sbol:Component; + sbol:description "AHL"; + sbol:displayId "AHL"; + sbol:hasNamespace ; + sbol:name "AHL"; + sbol:role CHEBI:35224; + sbol:type SBO:0000247 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent4" ; - sbol:instanceOf :ter_luxR ; + + a sbol:SubComponent; + sbol:displayId "SubComponent3"; + sbol:instanceOf :luxR; sbol:orientation SO:0001030 . -:OrganismB a sbol:Component ; - sbol:description "Organism B" ; - sbol:displayId "OrganismB" ; - sbol:hasNamespace ; - sbol:name "OrganismB" ; - sbol:role SBO:0000290 ; - sbol:type GO:0005623 . - - - a sbol:SubComponent ; - sbol:displayId "SubComponent9" ; - sbol:instanceOf :AHL . + + a sbol:SubComponent; + sbol:displayId "SubComponent11"; + sbol:instanceOf :GFP_protein . - - a sbol:Constraint ; - sbol:displayId "Constraint2" ; - sbol:object ; - sbol:restriction sbol:contains ; - sbol:subject . +:LuxR_protein a sbol:Component; + sbol:description "LuxR"; + sbol:displayId "LuxR_protein"; + sbol:hasNamespace ; + sbol:name "LuxR_protein"; + sbol:role GO:0003700; + sbol:type SBO:0000252 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent5" ; - sbol:instanceOf :AHL . +:OrganismB a sbol:Component; + sbol:description "Organism B"; + sbol:displayId "OrganismB"; + sbol:hasNamespace ; + sbol:name "OrganismB"; + sbol:role SBO:0000290; + sbol:type GO:0005623 . - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; + a sbol:SubComponent; + sbol:displayId "SubComponent1"; sbol:instanceOf :OrganismA . -:LuxR_protein a sbol:Component ; - sbol:description "LuxR" ; - sbol:displayId "LuxR_protein" ; - sbol:hasNamespace ; - sbol:name "LuxR_protein" ; - sbol:role GO:0003700 ; - sbol:type SBO:0000252 . +:luxR a sbol:Component; + sbol:description "luxR coding sequence"; + sbol:displayId "luxR"; + sbol:hasNamespace ; + sbol:name "luxR"; + sbol:role SO:0000316; + sbol:type SBO:0000251 . - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; - sbol:role SBO:0000011 . +:AHL_receiver a sbol:Component; + sbol:description "AHL receiver"; + sbol:displayId "AHL_receiver"; + sbol:hasFeature , , , , , , , , , , , ; + sbol:hasInteraction , , , ; + sbol:hasNamespace ; + sbol:name "AHL receiver"; + sbol:role SO:0000704; + sbol:type SBO:0000251 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent3" ; - sbol:instanceOf :luxR ; - sbol:orientation SO:0001030 . + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000010 . -:gfp a sbol:Component ; - sbol:description "gfp coding sequence" ; - sbol:displayId "gfp" ; - sbol:hasNamespace ; - sbol:name "gfp" ; - sbol:role SO:0000316 ; +:pConstLuxI a sbol:Component; + sbol:description "Constitutive promoter"; + sbol:displayId "pConstLuxI"; + sbol:hasNamespace ; + sbol:name "pConstLuxI"; + sbol:role SO:0000167; sbol:type SBO:0000251 . -:ReceiverSystem a sbol:Component ; - sbol:description "Receiver System" ; - sbol:displayId "ReceiverSystem" ; - sbol:hasConstraint , , ; - sbol:hasFeature , , , ; - sbol:hasNamespace ; - sbol:name "ReceiverSystem" ; - sbol:role SBO:0000289 ; - sbol:type SBO:0000241 . + + a sbol:Interaction; + sbol:displayId "Interaction4"; + sbol:hasParticipation , , ; + sbol:type SBO:0000177 . -:LuxR_AHL a sbol:Component ; - sbol:description "LuxR_AHL complex" ; - sbol:displayId "LuxR_AHL" ; - sbol:hasNamespace ; - sbol:name "LuxR_AHL" ; - sbol:role GO:0003700 ; - sbol:type SBO:0000252 . + + a sbol:Constraint; + sbol:displayId "Constraint1"; + sbol:object ; + sbol:restriction sbol:contains; + sbol:subject . -:rbs_luxI a sbol:Component ; - sbol:description "RBS" ; - sbol:displayId "rbs_luxI" ; - sbol:hasNamespace ; - sbol:name "rbs" ; - sbol:role SO:0000139 ; - sbol:type SBO:0000251 . + + a sbol:Constraint; + sbol:displayId "Constraint2"; + sbol:object ; + sbol:restriction sbol:contains; + sbol:subject . - - a sbol:SubComponent ; - sbol:displayId "SubComponent12" ; - sbol:instanceOf :LuxR_AHL . + + a sbol:ComponentReference; + sbol:displayId "ComponentReference1"; + sbol:inChildOf ; + sbol:refersTo . -:OrganismA a sbol:Component ; - sbol:description "Organism A" ; - sbol:displayId "OrganismA" ; - sbol:hasNamespace ; - sbol:name "OrganismA" ; - sbol:role SBO:0000290 ; - sbol:type GO:0005623 . + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000011 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent8" ; - sbol:instanceOf :ter_gfp ; - sbol:orientation SO:0001030 . +:rbs_luxI a sbol:Component; + sbol:description "RBS"; + sbol:displayId "rbs_luxI"; + sbol:hasNamespace ; + sbol:name "rbs"; + sbol:role SO:0000139; + sbol:type SBO:0000251 . - - a sbol:Constraint ; - sbol:displayId "Constraint1" ; - sbol:object ; - sbol:restriction sbol:contains ; - sbol:subject . +:ter_luxI a sbol:Component; + sbol:description "Terminator"; + sbol:displayId "ter_luxI"; + sbol:hasNamespace ; + sbol:name "luxI terminator"; + sbol:role SO:0000141; + sbol:type SBO:0000251 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent4" ; - sbol:instanceOf :ter_luxI ; + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :pConstLuxI; sbol:orientation SO:0001030 . -:pLuxR a sbol:Component ; - sbol:description "LuxR inducible promoter" ; - sbol:displayId "pLuxR" ; - sbol:hasNamespace ; - sbol:name "pLuxR" ; - sbol:role SO:0000167 ; - sbol:type SBO:0000251 . + + a sbol:SubComponent; + sbol:displayId "SubComponent5"; + sbol:instanceOf :pLuxR; + sbol:orientation SO:0001030 . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000645 . + + a sbol:SubComponent; + sbol:displayId "SubComponent3"; + sbol:instanceOf :AHL_producer . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :rbs_luxR ; - sbol:orientation SO:0001030 . + + a sbol:Participation; + sbol:displayId "Participation3"; + sbol:participant ; + sbol:role SBO:0000011 . - - a sbol:Interaction ; - sbol:displayId "Interaction4" ; - sbol:hasParticipation , , ; - sbol:type SBO:0000177 . + + a sbol:Constraint; + sbol:displayId "Constraint3"; + sbol:object ; + sbol:restriction sbol:verifyIdentical; + sbol:subject . -:GFP_protein a sbol:Component ; - sbol:description "GFP" ; - sbol:displayId "GFP_protein" ; - sbol:hasNamespace ; - sbol:name "GFP" ; - sbol:type SBO:0000252 . + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000011 . -:luxI a sbol:Component ; - sbol:description "luxI coding sequence" ; - sbol:displayId "luxI" ; - sbol:hasNamespace ; - sbol:name "luxI" ; - sbol:role SO:0000316 ; +:pLuxR a sbol:Component; + sbol:description "LuxR inducible promoter"; + sbol:displayId "pLuxR"; + sbol:hasNamespace ; + sbol:name "pLuxR"; + sbol:role SO:0000167; sbol:type SBO:0000251 . - - a sbol:Constraint ; - sbol:displayId "Constraint3" ; - sbol:object ; - sbol:restriction sbol:verifyIdentical ; - sbol:subject . +:SenderSystem a sbol:Component; + sbol:description "Sender System"; + sbol:displayId "SenderSystem"; + sbol:hasConstraint , , ; + sbol:hasFeature , , , ; + sbol:hasNamespace ; + sbol:name "SenderSystem"; + sbol:role SBO:0000289; + sbol:type SBO:0000241 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent11" ; - sbol:instanceOf :GFP_protein . + + a sbol:Interaction; + sbol:displayId "Interaction1"; + sbol:hasParticipation , ; + sbol:type SBO:0000589 . -:AHL_producer a sbol:Component ; - sbol:description "AHL producer" ; - sbol:displayId "AHL_producer" ; - sbol:hasFeature , , , , ; - sbol:hasInteraction ; - sbol:hasNamespace ; - sbol:name "AHL producer" ; - sbol:role SO:0000704 ; - sbol:type SBO:0000251 . +:pConstLuxR a sbol:Component; + sbol:description "Constituve promoter"; + sbol:displayId "pConstLuxR"; + sbol:hasNamespace ; + sbol:name "pLuxR"; + sbol:role SO:0000167; + sbol:type SBO:0000251 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent3"; + sbol:instanceOf :luxI; + sbol:orientation SO:0001030 . - a sbol:SubComponent ; - sbol:displayId "SubComponent7" ; - sbol:instanceOf :gfp ; + a sbol:SubComponent; + sbol:displayId "SubComponent7"; + sbol:instanceOf :gfp; sbol:orientation SO:0001030 . -:AHL a sbol:Component ; - sbol:description "AHL" ; - sbol:displayId "AHL" ; - sbol:hasNamespace ; - sbol:name "AHL" ; - sbol:role CHEBI:35224 ; - sbol:type SBO:0000247 . +:AHL_producer a sbol:Component; + sbol:description "AHL producer"; + sbol:displayId "AHL_producer"; + sbol:hasFeature , , , , ; + sbol:hasInteraction ; + sbol:hasNamespace ; + sbol:name "AHL producer"; + sbol:role SO:0000704; + sbol:type SBO:0000251 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent3" ; - sbol:instanceOf :luxI ; - sbol:orientation SO:0001030 . + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :AHL . -:pConstLuxI a sbol:Component ; - sbol:description "Constitutive promoter" ; - sbol:displayId "pConstLuxI" ; - sbol:hasNamespace ; - sbol:name "pConstLuxI" ; - sbol:role SO:0000167 ; - sbol:type SBO:0000251 . + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :SenderSystem . - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :pConstLuxR ; - sbol:orientation SO:0001030 . + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000645 . -:ter_luxI a sbol:Component ; - sbol:description "Terminator" ; - sbol:displayId "ter_luxI" ; - sbol:hasNamespace ; - sbol:name "luxI terminator" ; - sbol:role SO:0000141 ; +:rbs_luxR a sbol:Component; + sbol:description "RBS"; + sbol:displayId "rbs_luxR"; + sbol:hasNamespace ; + sbol:name "rbs"; + sbol:role SO:0000139; sbol:type SBO:0000251 . - - a sbol:Interaction ; - sbol:displayId "Interaction3" ; - sbol:hasParticipation , ; - sbol:type SBO:0000170 . + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :rbs_luxR; + sbol:orientation SO:0001030 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent3" ; - sbol:instanceOf :AHL_receiver . + + a sbol:SubComponent; + sbol:displayId "SubComponent10"; + sbol:instanceOf :LuxR_protein . - - a sbol:Participation ; - sbol:displayId "Participation3" ; - sbol:participant ; - sbol:role SBO:0000011 . +:ter_luxR a sbol:Component; + sbol:description "Terminator"; + sbol:displayId "ter_luxR"; + sbol:hasNamespace ; + sbol:name "luxR terminator"; + sbol:role SO:0000141; + sbol:type SBO:0000251 . - - a sbol:ComponentReference ; - sbol:displayId "ComponentReference1" ; - sbol:inChildOf ; - sbol:refersTo . +:OrganismA a sbol:Component; + sbol:description "Organism A"; + sbol:displayId "OrganismA"; + sbol:hasNamespace ; + sbol:name "OrganismA"; + sbol:role SBO:0000290; + sbol:type GO:0005623 . - - a sbol:ComponentReference ; - sbol:displayId "ComponentReference1" ; - sbol:inChildOf ; - sbol:refersTo . +:ter_gfp a sbol:Component; + sbol:description "Terminator"; + sbol:displayId "ter_gfp"; + sbol:hasNamespace ; + sbol:name "gfp terminator"; + sbol:role SO:0000141; + sbol:type SBO:0000251 . - - a sbol:Constraint ; - sbol:displayId "Constraint2" ; - sbol:object ; - sbol:restriction sbol:contains ; - sbol:subject . + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000459 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent10" ; - sbol:instanceOf :LuxR_protein . + + a sbol:Interaction; + sbol:displayId "Interaction3"; + sbol:hasParticipation , ; + sbol:type SBO:0000170 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent6" ; - sbol:instanceOf :rbs_gfp ; - sbol:orientation SO:0001030 . + + a sbol:Constraint; + sbol:displayId "Constraint1"; + sbol:object ; + sbol:restriction sbol:contains; + sbol:subject . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :ReceiverSystem . + + a sbol:SubComponent; + sbol:displayId "SubComponent5"; + sbol:instanceOf :AHL . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :rbs_luxI ; - sbol:orientation SO:0001030 . + + a sbol:SubComponent; + sbol:displayId "SubComponent9"; + sbol:instanceOf :AHL . diff --git a/SBOL3/multicellular_simple/multicellular_simple.jsonld b/SBOL3/multicellular_simple/multicellular_simple.jsonld index 6142055..2da50f2 100644 --- a/SBOL3/multicellular_simple/multicellular_simple.jsonld +++ b/SBOL3/multicellular_simple/multicellular_simple.jsonld @@ -1,55 +1,15 @@ { "@graph": [ { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/OrganismB" - }, - "sbol:displayId": "SubComponent1", - "@type": "sbol:SubComponent" - }, - { - "@id": "https://sbolstandard.org/examples/OrganismB", - "sbol:type": { - "@id": "GO:0005623" - }, - "sbol:role": { - "@id": "SBO:0000290" - }, - "sbol:name": "OrganismB", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "OrganismB", - "sbol:description": "Organism B", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/ReceiverSystem", - "sbol:role": { - "@id": "SBO:0000289" - }, - "sbol:description": "Receiver System", - "sbol:name": "ReceiverSystem", - "@type": "sbol:Component", - "sbol:hasFeature": [ - { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - }, - { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" - } - ], - "sbol:displayId": "ReceiverSystem", - "sbol:hasConstraint": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" }, - "sbol:type": { - "@id": "SBO:0000241" + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" }, - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - } + "sbol:displayId": "ComponentReference2", + "@type": "sbol:ComponentReference" }, { "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", @@ -60,33 +20,21 @@ "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint1", - "sbol:subject": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" - }, - "sbol:restriction": { - "@id": "sbol:contains" - }, - "sbol:object": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem" }, - "sbol:displayId": "Constraint1", - "@type": "sbol:Constraint" + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/MulticellularSystem", + "@id": "https://sbolstandard.org/examples/ReceiverSystem", "sbol:hasFeature": [ { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" - }, - { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" - }, - { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" }, { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" } ], "sbol:hasNamespace": { @@ -95,69 +43,65 @@ "sbol:type": { "@id": "SBO:0000241" }, - "sbol:description": "Multicellular System", - "@type": "sbol:Component", "sbol:hasConstraint": { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" }, + "sbol:displayId": "ReceiverSystem", "sbol:role": { "@id": "SBO:0000289" }, - "sbol:name": "MulticellularSystem", - "sbol:displayId": "MulticellularSystem" - }, - { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", - "sbol:refersTo": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - }, - "sbol:inChildOf": { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" - }, - "sbol:displayId": "ComponentReference2", - "@type": "sbol:ComponentReference" + "@type": "sbol:Component", + "sbol:description": "Receiver System", + "sbol:name": "ReceiverSystem" }, { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/Constraint1", - "sbol:subject": { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" + "@id": "https://sbolstandard.org/examples/OrganismB", + "sbol:type": { + "@id": "GO:0005623" }, - "sbol:restriction": { - "@id": "sbol:verifyIdentical" + "sbol:role": { + "@id": "SBO:0000290" }, - "sbol:object": { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + "sbol:name": "OrganismB", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "Constraint1", - "@type": "sbol:Constraint" + "sbol:displayId": "OrganismB", + "sbol:description": "Organism B", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/SenderSystem" + "@id": "https://sbolstandard.org/examples/OrganismB" }, "sbol:displayId": "SubComponent1", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1", - "sbol:refersTo": { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - }, - "sbol:inChildOf": { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" - }, - "sbol:displayId": "ComponentReference1", - "@type": "sbol:ComponentReference" - }, - { - "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2", + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/ReceiverSystem" + "@id": "https://sbolstandard.org/examples/AHL" }, "sbol:displayId": "SubComponent2", "@type": "sbol:SubComponent" }, + { + "@id": "https://sbolstandard.org/examples/AHL", + "sbol:type": { + "@id": "SBO:0000247" + }, + "sbol:role": { + "@id": "CHEBI:35224" + }, + "sbol:name": "AHL", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "AHL", + "sbol:description": "AHL", + "@type": "sbol:Component" + }, { "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint1", "sbol:subject": { @@ -181,71 +125,127 @@ "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2", + "@id": "https://sbolstandard.org/examples/ReceiverSystem/Constraint1", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + }, + "sbol:restriction": { + "@id": "sbol:contains" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/AHL" + "@id": "https://sbolstandard.org/examples/SenderSystem" }, - "sbol:displayId": "SubComponent2", + "sbol:displayId": "SubComponent1", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/OrganismA", + "@id": "https://sbolstandard.org/examples/SenderSystem", + "sbol:description": "Sender System", + "sbol:role": { + "@id": "SBO:0000289" + }, + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + } + ], "sbol:type": { - "@id": "GO:0005623" + "@id": "SBO:0000241" }, - "sbol:role": { - "@id": "SBO:0000290" + "sbol:hasConstraint": { + "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint1" }, - "sbol:name": "OrganismA", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "OrganismA", - "sbol:description": "Organism A", + "sbol:displayId": "SenderSystem", + "sbol:name": "SenderSystem", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/AHL", + "@id": "https://sbolstandard.org/examples/OrganismA", "sbol:type": { - "@id": "SBO:0000247" + "@id": "GO:0005623" }, "sbol:role": { - "@id": "CHEBI:35224" + "@id": "SBO:0000290" }, - "sbol:name": "AHL", + "sbol:name": "OrganismA", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "AHL", - "sbol:description": "AHL", + "sbol:displayId": "OrganismA", + "sbol:description": "Organism A", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/SenderSystem", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, + "@id": "https://sbolstandard.org/examples/MulticellularSystem", "sbol:hasFeature": [ { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" }, { - "@id": "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" } ], - "sbol:description": "Sender System", - "sbol:hasConstraint": { - "@id": "https://sbolstandard.org/examples/SenderSystem/Constraint1" + "sbol:type": { + "@id": "SBO:0000241" }, - "sbol:name": "SenderSystem", - "sbol:displayId": "SenderSystem", - "@type": "sbol:Component", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:name": "MulticellularSystem", + "sbol:description": "Multicellular System", "sbol:role": { "@id": "SBO:0000289" }, - "sbol:type": { - "@id": "SBO:0000241" + "sbol:displayId": "MulticellularSystem", + "@type": "sbol:Component", + "sbol:hasConstraint": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" } + }, + { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/Constraint1", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" + }, + "sbol:restriction": { + "@id": "sbol:verifyIdentical" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" } ], "@context": { diff --git a/SBOL3/multicellular_simple/multicellular_simple.jsonld_expanded b/SBOL3/multicellular_simple/multicellular_simple.jsonld_expanded index f84c776..7aa8234 100644 --- a/SBOL3/multicellular_simple/multicellular_simple.jsonld_expanded +++ b/SBOL3/multicellular_simple/multicellular_simple.jsonld_expanded @@ -1,278 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/AHL", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000247" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/CHEBI:35224" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "AHL" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "AHL" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "AHL" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem", - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" - }, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Multicellular System" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#hasConstraint" : [ { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000289" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "MulticellularSystem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "MulticellularSystem" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1", - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - } ], - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference1" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2", - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - } ], - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference2" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/Constraint1", - "http://sbols.org/v3#subject" : [ { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#verifyIdentical" - } ], - "http://sbols.org/v3#object" : [ { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint1" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/OrganismA", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/GO:0005623" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000290" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "OrganismA" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "OrganismA" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Organism A" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/OrganismB", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/GO:0005623" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000290" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "OrganismB" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "OrganismB" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Organism B" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000289" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Receiver System" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "ReceiverSystem" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - }, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ReceiverSystem" - } ], - "http://sbols.org/v3#hasConstraint" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint1", - "http://sbols.org/v3#subject" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#contains" - } ], - "http://sbols.org/v3#object" : [ { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint1" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/OrganismB" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/AHL" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/SenderSystem", - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Sender System" - } ], - "http://sbols.org/v3#hasConstraint" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/Constraint1" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "SenderSystem" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SenderSystem" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000289" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/Constraint1", - "http://sbols.org/v3#subject" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#contains" - } ], - "http://sbols.org/v3#object" : [ { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint1" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/OrganismA" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/AHL" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent2"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference2"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/AHL"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/ReceiverSystem","http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent1"},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent2"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#hasConstraint":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/Constraint1"}],"http://sbols.org/v3#displayId":[{"@value":"ReceiverSystem"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000289"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#description":[{"@value":"Receiver System"}],"http://sbols.org/v3#name":[{"@value":"ReceiverSystem"}]},{"@id":"https://sbolstandard.org/examples/OrganismB","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/GO:0005623"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000290"}],"http://sbols.org/v3#name":[{"@value":"OrganismB"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"OrganismB"}],"http://sbols.org/v3#description":[{"@value":"Organism B"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/OrganismB"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/AHL"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/AHL","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000247"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/CHEBI:35224"}],"http://sbols.org/v3#name":[{"@value":"AHL"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"AHL"}],"http://sbols.org/v3#description":[{"@value":"AHL"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/SenderSystem/Constraint1","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#contains"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint1"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/OrganismA"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/ReceiverSystem/Constraint1","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#contains"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/ReceiverSystem/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint1"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent2"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference1"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/SenderSystem"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/SenderSystem","http://sbols.org/v3#description":[{"@value":"Sender System"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000289"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent2"},{"@id":"https://sbolstandard.org/examples/SenderSystem/SubComponent1"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#hasConstraint":[{"@id":"https://sbolstandard.org/examples/SenderSystem/Constraint1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"SenderSystem"}],"http://sbols.org/v3#name":[{"@value":"SenderSystem"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/OrganismA","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/GO:0005623"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000290"}],"http://sbols.org/v3#name":[{"@value":"OrganismA"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"OrganismA"}],"http://sbols.org/v3#description":[{"@value":"Organism A"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/MulticellularSystem","http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2"},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/SubComponent2"},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/SubComponent1"},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#name":[{"@value":"MulticellularSystem"}],"http://sbols.org/v3#description":[{"@value":"Multicellular System"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000289"}],"http://sbols.org/v3#displayId":[{"@value":"MulticellularSystem"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#hasConstraint":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/Constraint1"}]},{"@id":"https://sbolstandard.org/examples/MulticellularSystem/Constraint1","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#verifyIdentical"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint1"}],"@type":["http://sbols.org/v3#Constraint"]}]} \ No newline at end of file diff --git a/SBOL3/multicellular_simple/multicellular_simple.nt b/SBOL3/multicellular_simple/multicellular_simple.nt index 4d4c82a..455a033 100644 --- a/SBOL3/multicellular_simple/multicellular_simple.nt +++ b/SBOL3/multicellular_simple/multicellular_simple.nt @@ -1,48 +1,40 @@ + . + . + "ComponentReference2" . + . + . + "SubComponent2" . + . + . + . + "OrganismB" . + . + "OrganismB" . + "Organism B" . + . . "SubComponent1" . . - . - "Receiver System" . - "ReceiverSystem" . - . - . - "ReceiverSystem" . - . - . - . - . - . - . - . - "Multicellular System" . - . - . - . - "MulticellularSystem" . - . - . - . - "MulticellularSystem" . - . - . - . - "Constraint1" . - . + . + "SubComponent2" . + . . . . "Constraint1" . . - . - "SubComponent1" . - . - . - "SubComponent2" . - . - . - . - "ComponentReference2" . - . + . + . + . + "Constraint1" . + . + . + . + "ComponentReference1" . + . + . + "SubComponent1" . + . . . "OrganismA" . @@ -50,27 +42,44 @@ "OrganismA" . "Organism A" . . - . - . - . - "Constraint1" . - . + . + . + . + . + "ReceiverSystem" . + . + . + "Receiver System" . + "ReceiverSystem" . + . + . + "SubComponent1" . + . + . + . + . + . + "MulticellularSystem" . + "Multicellular System" . + . + "MulticellularSystem" . + . + . + . + . . "SubComponent2" . . - . - "SubComponent2" . - . - . - . "Sender System" . + . + . + . . - "SenderSystem" . + . "SenderSystem" . + "SenderSystem" . + . . - . - . - . . . "AHL" . @@ -78,17 +87,8 @@ "AHL" . "AHL" . . - . - . - "OrganismB" . - . - "OrganismB" . - "Organism B" . - . - . - "SubComponent1" . - . - . - . - "ComponentReference1" . - . + . + . + . + "Constraint1" . + . diff --git a/SBOL3/multicellular_simple/multicellular_simple.rdf b/SBOL3/multicellular_simple/multicellular_simple.rdf index 2bf21ea..300e711 100644 --- a/SBOL3/multicellular_simple/multicellular_simple.rdf +++ b/SBOL3/multicellular_simple/multicellular_simple.rdf @@ -10,14 +10,68 @@ xmlns="https://sbolstandard.org/examples/" xmlns:om="http://www.ontology-of-units-of-measure.org/resource/om-2/" xml:base="https://sbolstandard.org/examples/"> + + Sender System + + + + + + + SubComponent2 + + + + + + + + + + + SubComponent1 + + + + + Constraint1 + + + + SenderSystem + SenderSystem + + + + + + AHL + + AHL + AHL + + + + + OrganismA + + OrganismA + Organism A + + + + + OrganismB + + OrganismB + Organism B + - - - + SubComponent2 @@ -32,29 +86,25 @@ ComponentReference2 - + + + MulticellularSystem Multicellular System + + MulticellularSystem + + + + SubComponent1 + + - - - - - - SubComponent2 - - - - - - - - SubComponent1 - - + + ComponentReference1 @@ -63,85 +113,29 @@ Constraint1 - - MulticellularSystem - - - MulticellularSystem - - Receiver System - ReceiverSystem - - ReceiverSystem - - - - - - - - SubComponent1 - - - - - Constraint1 - - - - - - - - - - - - + + SubComponent1 - Sender System + + - - + + - + Constraint1 - SenderSystem - SenderSystem + ReceiverSystem - - - - - - - AHL - - AHL - AHL - - - - - OrganismA - - OrganismA - Organism A - - - - - OrganismB - - OrganismB - Organism B + Receiver System + ReceiverSystem + diff --git a/SBOL3/multicellular_simple/multicellular_simple.rj b/SBOL3/multicellular_simple/multicellular_simple.rj index 4fb2c5f..90e7aab 100644 --- a/SBOL3/multicellular_simple/multicellular_simple.rj +++ b/SBOL3/multicellular_simple/multicellular_simple.rj @@ -1,8 +1,17 @@ { - "https://sbolstandard.org/examples/MulticellularSystem" : { + "https://sbolstandard.org/examples/SenderSystem" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "MulticellularSystem" + "value" : "SenderSystem" } ] , "http://sbols.org/v3#role" : [ { @@ -10,9 +19,9 @@ "value" : "https://identifiers.org/SBO:0000289" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Sender System" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -22,121 +31,91 @@ ] , "http://sbols.org/v3#hasConstraint" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" + "value" : "https://sbolstandard.org/examples/SenderSystem/Constraint1" } ] , - "http://sbols.org/v3#hasFeature" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" - } - , { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + "value" : "https://identifiers.org/SBO:0000241" } ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "MulticellularSystem" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Multicellular System" + "value" : "SenderSystem" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" : { + "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "Constraint1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#restriction" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem" - } - ] - } - , - "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "SubComponent1" + "value" : "http://sbols.org/v3#verifyIdentical" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#object" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem" + "value" : "http://sbols.org/v3#Constraint" } ] } , - "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" : { + "https://sbolstandard.org/examples/SenderSystem/Constraint1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "Constraint1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" - } - ] , "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" } ] , "http://sbols.org/v3#restriction" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#verifyIdentical" + "value" : "http://sbols.org/v3#contains" } ] , "http://sbols.org/v3#object" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Constraint" } ] } , - "https://sbolstandard.org/examples/OrganismA" : { + "https://sbolstandard.org/examples/AHL" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "OrganismA" + "value" : "AHL" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000290" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/CHEBI:35224" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -144,80 +123,60 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "OrganismA" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "Organism A" + "value" : "AHL" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/GO:0005623" - } - ] - } - , - "https://sbolstandard.org/examples/OrganismB" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "OrganismB" + "value" : "https://identifiers.org/SBO:0000247" } ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000290" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "AHL" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Component" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , - "http://sbols.org/v3#name" : [ { + ] + } + , + "https://sbolstandard.org/examples/SenderSystem/SubComponent2" : { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "OrganismB" + "value" : "SubComponent2" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Organism B" + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/AHL" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/GO:0005623" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" : { + "https://sbolstandard.org/examples/SenderSystem/SubComponent1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ComponentReference1" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" + "value" : "SubComponent1" } ] , - "http://sbols.org/v3#inChildOf" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" + "value" : "https://sbolstandard.org/examples/OrganismA" } ] , - "http://sbols.org/v3#refersTo" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + "value" : "http://sbols.org/v3#SubComponent" } ] } @@ -228,14 +187,14 @@ "value" : "ComponentReference2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#inChildOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" + "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" } ] , - "http://sbols.org/v3#inChildOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" + "value" : "http://sbols.org/v3#ComponentReference" } ] , "http://sbols.org/v3#refersTo" : [ { @@ -251,11 +210,6 @@ "value" : "Constraint1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" - } - ] , "http://sbols.org/v3#subject" : [ { "type" : "uri" , "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" @@ -269,48 +223,56 @@ "http://sbols.org/v3#object" : [ { "type" : "uri" , "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Constraint" } ] } , - "https://sbolstandard.org/examples/ReceiverSystem" : { + "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ReceiverSystem" + "value" : "SubComponent2" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000289" + "value" : "https://sbolstandard.org/examples/ReceiverSystem" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#SubComponent" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + ] + } + , + "https://sbolstandard.org/examples/ReceiverSystem" : { + "http://sbols.org/v3#hasFeature" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" } - ] , - "http://sbols.org/v3#hasConstraint" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" + "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "ReceiverSystem" } ] , - "http://sbols.org/v3#hasFeature" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" + "value" : "https://identifiers.org/SBO:0000289" } - , { + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" + "value" : "https://sbolstandard.org/examples" } ] , "http://sbols.org/v3#description" : [ { @@ -318,97 +280,114 @@ "value" : "Receiver System" } ] , + "http://sbols.org/v3#hasConstraint" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/ReceiverSystem/Constraint1" + } + ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000241" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "ReceiverSystem" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" : { + "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "SubComponent1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/SenderSystem" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/SenderSystem" : { + "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SenderSystem" + "value" : "SubComponent1" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000289" + "value" : "https://sbolstandard.org/examples/OrganismB" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ComponentReference1" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#inChildOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" } ] , - "http://sbols.org/v3#hasConstraint" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/Constraint1" + "value" : "http://sbols.org/v3#ComponentReference" } ] , - "http://sbols.org/v3#hasFeature" : [ { + "http://sbols.org/v3#refersTo" : [ { "type" : "uri" , "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" - } - ] , - "http://sbols.org/v3#name" : [ { + ] + } + , + "https://sbolstandard.org/examples/ReceiverSystem/SubComponent2" : { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SenderSystem" + "value" : "SubComponent2" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Sender System" + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/AHL" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/AHL" : { + "https://sbolstandard.org/examples/OrganismA" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "AHL" + "value" : "OrganismA" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/CHEBI:35224" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SBO:0000290" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -416,101 +395,122 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "AHL" + "value" : "Organism A" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/GO:0005623" + } + ] , + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "AHL" + "value" : "OrganismA" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000247" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/ReceiverSystem/SubComponent1" : { + "https://sbolstandard.org/examples/OrganismB" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent1" + "value" : "OrganismB" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000290" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/OrganismB" + "value" : "https://sbolstandard.org/examples" } - ] - } - , - "https://sbolstandard.org/examples/SenderSystem/SubComponent2" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "Organism B" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/GO:0005623" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "OrganismB" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/AHL" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/SenderSystem/Constraint1" : { + "https://sbolstandard.org/examples/MulticellularSystem" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/MulticellularSystem/ComponentReference2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/MulticellularSystem/SubComponent1" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Constraint1" + "value" : "MulticellularSystem" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" + "value" : "https://identifiers.org/SBO:0000289" } ] , - "http://sbols.org/v3#subject" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent1" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#restriction" : [ { + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Multicellular System" + } + ] , + "http://sbols.org/v3#hasConstraint" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#contains" + "value" : "https://sbolstandard.org/examples/MulticellularSystem/Constraint1" } ] , - "http://sbols.org/v3#object" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/SenderSystem/SubComponent2" + "value" : "https://identifiers.org/SBO:0000241" } - ] - } - , - "https://sbolstandard.org/examples/SenderSystem/SubComponent1" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "SubComponent1" + "value" : "MulticellularSystem" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" - } - ] , - "http://sbols.org/v3#instanceOf" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/OrganismA" + "value" : "http://sbols.org/v3#Component" } ] } diff --git a/SBOL3/multicellular_simple/multicellular_simple.ttl b/SBOL3/multicellular_simple/multicellular_simple.ttl index ea2b3aa..9c3656f 100644 --- a/SBOL3/multicellular_simple/multicellular_simple.ttl +++ b/SBOL3/multicellular_simple/multicellular_simple.ttl @@ -1,127 +1,127 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :OrganismB . + + a sbol:ComponentReference; + sbol:displayId "ComponentReference2"; + sbol:inChildOf ; + sbol:refersTo . -:ReceiverSystem a sbol:Component ; - sbol:description "Receiver System" ; - sbol:displayId "ReceiverSystem" ; - sbol:hasConstraint ; - sbol:hasFeature , ; - sbol:hasNamespace ; - sbol:name "ReceiverSystem" ; - sbol:role SBO:0000289 ; - sbol:type SBO:0000241 . + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :ReceiverSystem . -:MulticellularSystem a sbol:Component ; - sbol:description "Multicellular System" ; - sbol:displayId "MulticellularSystem" ; - sbol:hasConstraint ; - sbol:hasFeature , , , ; - sbol:hasNamespace ; - sbol:name "MulticellularSystem" ; - sbol:role SBO:0000289 ; - sbol:type SBO:0000241 . +:OrganismB a sbol:Component; + sbol:description "Organism B"; + sbol:displayId "OrganismB"; + sbol:hasNamespace ; + sbol:name "OrganismB"; + sbol:role SBO:0000290; + sbol:type GO:0005623 . - - a sbol:Constraint ; - sbol:displayId "Constraint1" ; - sbol:object ; - sbol:restriction sbol:verifyIdentical ; - sbol:subject . + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :OrganismB . + + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :AHL . - a sbol:Constraint ; - sbol:displayId "Constraint1" ; - sbol:object ; - sbol:restriction sbol:contains ; + a sbol:Constraint; + sbol:displayId "Constraint1"; + sbol:object ; + sbol:restriction sbol:contains; sbol:subject . - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :OrganismA . + + a sbol:Constraint; + sbol:displayId "Constraint1"; + sbol:object ; + sbol:restriction sbol:contains; + sbol:subject . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :ReceiverSystem . + + a sbol:ComponentReference; + sbol:displayId "ComponentReference1"; + sbol:inChildOf ; + sbol:refersTo . - - a sbol:ComponentReference ; - sbol:displayId "ComponentReference2" ; - sbol:inChildOf ; - sbol:refersTo . + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :SenderSystem . -:OrganismA a sbol:Component ; - sbol:description "Organism A" ; - sbol:displayId "OrganismA" ; - sbol:hasNamespace ; - sbol:name "OrganismA" ; - sbol:role SBO:0000290 ; +:OrganismA a sbol:Component; + sbol:description "Organism A"; + sbol:displayId "OrganismA"; + sbol:hasNamespace ; + sbol:name "OrganismA"; + sbol:role SBO:0000290; sbol:type GO:0005623 . - - a sbol:Constraint ; - sbol:displayId "Constraint1" ; - sbol:object ; - sbol:restriction sbol:contains ; - sbol:subject . +:ReceiverSystem a sbol:Component; + sbol:description "Receiver System"; + sbol:displayId "ReceiverSystem"; + sbol:hasConstraint ; + sbol:hasFeature , ; + sbol:hasNamespace ; + sbol:name "ReceiverSystem"; + sbol:role SBO:0000289; + sbol:type SBO:0000241 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :AHL . + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :OrganismA . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; +:MulticellularSystem a sbol:Component; + sbol:description "Multicellular System"; + sbol:displayId "MulticellularSystem"; + sbol:hasConstraint ; + sbol:hasFeature , , , ; + sbol:hasNamespace ; + sbol:name "MulticellularSystem"; + sbol:role SBO:0000289; + sbol:type SBO:0000241 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; sbol:instanceOf :AHL . -:SenderSystem a sbol:Component ; - sbol:description "Sender System" ; - sbol:displayId "SenderSystem" ; - sbol:hasConstraint ; - sbol:hasFeature , ; - sbol:hasNamespace ; - sbol:name "SenderSystem" ; - sbol:role SBO:0000289 ; +:SenderSystem a sbol:Component; + sbol:description "Sender System"; + sbol:displayId "SenderSystem"; + sbol:hasConstraint ; + sbol:hasFeature , ; + sbol:hasNamespace ; + sbol:name "SenderSystem"; + sbol:role SBO:0000289; sbol:type SBO:0000241 . -:AHL a sbol:Component ; - sbol:description "AHL" ; - sbol:displayId "AHL" ; - sbol:hasNamespace ; - sbol:name "AHL" ; - sbol:role CHEBI:35224 ; +:AHL a sbol:Component; + sbol:description "AHL"; + sbol:displayId "AHL"; + sbol:hasNamespace ; + sbol:name "AHL"; + sbol:role CHEBI:35224; sbol:type SBO:0000247 . -:OrganismB a sbol:Component ; - sbol:description "Organism B" ; - sbol:displayId "OrganismB" ; - sbol:hasNamespace ; - sbol:name "OrganismB" ; - sbol:role SBO:0000290 ; - sbol:type GO:0005623 . - - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :SenderSystem . - - - a sbol:ComponentReference ; - sbol:displayId "ComponentReference1" ; - sbol:inChildOf ; - sbol:refersTo . + + a sbol:Constraint; + sbol:displayId "Constraint1"; + sbol:object ; + sbol:restriction sbol:verifyIdentical; + sbol:subject . diff --git a/SBOL3/provenance_entity/activity/activity.jsonld b/SBOL3/provenance_entity/activity/activity.jsonld index 67baec2..a70e703 100644 --- a/SBOL3/provenance_entity/activity/activity.jsonld +++ b/SBOL3/provenance_entity/activity/activity.jsonld @@ -1,78 +1,79 @@ { "@graph": [ { - "@id": "https://sbolstandard.org/examples/toggle_switch_optimised", - "prov:wasDerivedFrom": { - "@id": "https://sbolstandard.org/examples/toggle_switch" + "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Usage1", + "prov:hadRole": { + "@id": "sbol:learn" }, - "prov:wasGeneratedBy": { - "@id": "https://sbolstandard.org/examples/codon_optimization_activity" + "prov:entity": { + "@id": "https://sbolstandard.org/examples/toggle_switch" }, - "sbol:description": "Toggle Switch genetic circuit - codon optimised", - "sbol:name": "Toggle Switch Optimised", + "@type": [ + "sbol:Identified", + "prov:Usage" + ], + "sbol:displayId": "Usage1" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch", + "sbol:description": "Toggle Switch genetic circuit", + "sbol:name": "Toggle Switch", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, "sbol:type": { "@id": "SBO:0000241" }, - "sbol:displayId": "toggle_switch_optimised", + "sbol:displayId": "toggle_switch", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/toggle_switch", - "sbol:description": "Toggle Switch genetic circuit", - "sbol:name": "Toggle Switch", + "@id": "https://sbolstandard.org/examples/toggle_switch_optimised", + "prov:wasDerivedFrom": { + "@id": "https://sbolstandard.org/examples/toggle_switch" + }, + "prov:wasGeneratedBy": { + "@id": "https://sbolstandard.org/examples/codon_optimization_activity" + }, + "sbol:description": "Toggle Switch genetic circuit - codon optimised", + "sbol:name": "Toggle Switch Optimised", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, "sbol:type": { "@id": "SBO:0000241" }, - "sbol:displayId": "toggle_switch", + "sbol:displayId": "toggle_switch_optimised", "@type": "sbol:Component" }, { "@id": "https://sbolstandard.org/examples/codon_optimization_activity", - "sbol:type": { - "@id": "sbol:design" + "prov:qualifiedAssociation": { + "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Association1" }, + "prov:endedAtTime": "2019-08-30T00:00:00Z", "@type": [ "sbol:TopLevel", "prov:Activity" ], - "sbol:name": "Codon optimization activity", - "sbol:description": "An activity that is used to optimise codons", + "sbol:displayId": "codon_optimization_activity", "prov:qualifiedUsage": [ { - "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Usage2" + "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Usage1" }, { - "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Usage1" + "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Usage2" } ], - "sbol:displayId": "codon_optimization_activity", - "prov:startedAtTime": "2019-07-29T16:50:59Z", - "prov:endedAtTime": "2019-08-30T00:00:00Z", - "prov:qualifiedAssociation": { - "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Association1" - }, - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - } - }, - { - "@id": "https://sbolstandard.org/examples/CodonOptimiserSoftware", - "sbol:description": "Used to optimise bacterial DNA sequences.", - "sbol:name": "Codon Optimiser Software", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "@type": [ - "sbol:TopLevel", - "prov:Agent" - ], - "sbol:displayId": "CodonOptimiserSoftware" + "sbol:name": "Codon optimization activity", + "prov:startedAtTime": "2019-07-29T16:50:59Z", + "sbol:description": "An activity that is used to optimise codons", + "sbol:type": { + "@id": "sbol:design" + } }, { "@id": "https://sbolstandard.org/examples/RBS_optimisation_activity", @@ -93,6 +94,19 @@ ], "sbol:displayId": "RBS_optimisation_activity" }, + { + "@id": "https://sbolstandard.org/examples/CodonOptimiserSoftware", + "sbol:description": "Used to optimise bacterial DNA sequences.", + "sbol:name": "Codon Optimiser Software", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": [ + "sbol:TopLevel", + "prov:Agent" + ], + "sbol:displayId": "CodonOptimiserSoftware" + }, { "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Association1", "prov:hadRole": { @@ -111,45 +125,31 @@ "sbol:displayId": "Association1" }, { - "@id": "https://sbolstandard.org/examples/CodonOptimisationProtocol", - "sbol:description": "Optimisation protocol to improve the translation of mRNAs.", - "sbol:name": "Codon Optimisation Protocol", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "@type": [ - "sbol:TopLevel", - "prov:Plan" - ], - "sbol:displayId": "CodonOptimisationProtocol" - }, - { - "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Usage1", + "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Usage2", "prov:hadRole": { - "@id": "sbol:learn" + "@id": "sbol:design" }, "prov:entity": { - "@id": "https://sbolstandard.org/examples/toggle_switch" + "@id": "https://sbolstandard.org/examples/toggle_switch_optimised" }, "@type": [ "sbol:Identified", "prov:Usage" ], - "sbol:displayId": "Usage1" + "sbol:displayId": "Usage2" }, { - "@id": "https://sbolstandard.org/examples/codon_optimization_activity/Usage2", - "prov:hadRole": { - "@id": "sbol:design" - }, - "prov:entity": { - "@id": "https://sbolstandard.org/examples/toggle_switch_optimised" + "@id": "https://sbolstandard.org/examples/CodonOptimisationProtocol", + "sbol:description": "Optimisation protocol to improve the translation of mRNAs.", + "sbol:name": "Codon Optimisation Protocol", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, "@type": [ - "sbol:Identified", - "prov:Usage" + "sbol:TopLevel", + "prov:Plan" ], - "sbol:displayId": "Usage2" + "sbol:displayId": "CodonOptimisationProtocol" } ], "@context": { diff --git a/SBOL3/provenance_entity/activity/activity.jsonld_expanded b/SBOL3/provenance_entity/activity/activity.jsonld_expanded index 32b9a88..7743475 100644 --- a/SBOL3/provenance_entity/activity/activity.jsonld_expanded +++ b/SBOL3/provenance_entity/activity/activity.jsonld_expanded @@ -1,165 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/CodonOptimisationProtocol", - "http://sbols.org/v3#description" : [ { - "@value" : "Optimisation protocol to improve the translation of mRNAs." - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "Codon Optimisation Protocol" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.w3.org/ns/prov#Plan" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "CodonOptimisationProtocol" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/CodonOptimiserSoftware", - "http://sbols.org/v3#description" : [ { - "@value" : "Used to optimise bacterial DNA sequences." - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "Codon Optimiser Software" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.w3.org/ns/prov#Agent" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "CodonOptimiserSoftware" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/RBS_optimisation_activity", - "http://www.w3.org/ns/prov#wasInformedBy" : [ { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "An activity that is used to RBSs" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "RBS optimization activity" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "http://sbols.org/v3#design" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.w3.org/ns/prov#Activity" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "RBS_optimisation_activity" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity", - "http://sbols.org/v3#type" : [ { - "@id" : "http://sbols.org/v3#design" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.w3.org/ns/prov#Activity" ], - "http://sbols.org/v3#name" : [ { - "@value" : "Codon optimization activity" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "An activity that is used to optimise codons" - } ], - "http://www.w3.org/ns/prov#qualifiedUsage" : [ { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Usage2" - }, { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Usage1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "codon_optimization_activity" - } ], - "http://www.w3.org/ns/prov#startedAtTime" : [ { - "@value" : "2019-07-29T16:50:59Z" - } ], - "http://www.w3.org/ns/prov#endedAtTime" : [ { - "@value" : "2019-08-30T00:00:00Z" - } ], - "http://www.w3.org/ns/prov#qualifiedAssociation" : [ { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Association1" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Association1", - "http://www.w3.org/ns/prov#hadRole" : [ { - "@id" : "http://sbols.org/v3#design" - } ], - "http://www.w3.org/ns/prov#hadPlan" : [ { - "@id" : "https://sbolstandard.org/examples/CodonOptimisationProtocol" - } ], - "http://www.w3.org/ns/prov#agent" : [ { - "@id" : "https://sbolstandard.org/examples/CodonOptimiserSoftware" - } ], - "@type" : [ "http://sbols.org/v3#Identified", "http://www.w3.org/ns/prov#Association" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Association1" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Usage1", - "http://www.w3.org/ns/prov#hadRole" : [ { - "@id" : "http://sbols.org/v3#learn" - } ], - "http://www.w3.org/ns/prov#entity" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch" - } ], - "@type" : [ "http://sbols.org/v3#Identified", "http://www.w3.org/ns/prov#Usage" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Usage1" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity/Usage2", - "http://www.w3.org/ns/prov#hadRole" : [ { - "@id" : "http://sbols.org/v3#design" - } ], - "http://www.w3.org/ns/prov#entity" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch_optimised" - } ], - "@type" : [ "http://sbols.org/v3#Identified", "http://www.w3.org/ns/prov#Usage" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Usage2" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch", - "http://sbols.org/v3#description" : [ { - "@value" : "Toggle Switch genetic circuit" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "Toggle Switch" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "toggle_switch" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch_optimised", - "http://www.w3.org/ns/prov#wasDerivedFrom" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch" - } ], - "http://www.w3.org/ns/prov#wasGeneratedBy" : [ { - "@id" : "https://sbolstandard.org/examples/codon_optimization_activity" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Toggle Switch genetic circuit - codon optimised" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "Toggle Switch Optimised" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "toggle_switch_optimised" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/codon_optimization_activity/Usage1","http://www.w3.org/ns/prov#hadRole":[{"@id":"http://sbols.org/v3#learn"}],"http://www.w3.org/ns/prov#entity":[{"@id":"https://sbolstandard.org/examples/toggle_switch"}],"@type":["http://sbols.org/v3#Identified","http://www.w3.org/ns/prov#Usage"],"http://sbols.org/v3#displayId":[{"@value":"Usage1"}]},{"@id":"https://sbolstandard.org/examples/toggle_switch","http://sbols.org/v3#description":[{"@value":"Toggle Switch genetic circuit"}],"http://sbols.org/v3#name":[{"@value":"Toggle Switch"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#displayId":[{"@value":"toggle_switch"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/toggle_switch_optimised","http://www.w3.org/ns/prov#wasDerivedFrom":[{"@id":"https://sbolstandard.org/examples/toggle_switch"}],"http://www.w3.org/ns/prov#wasGeneratedBy":[{"@id":"https://sbolstandard.org/examples/codon_optimization_activity"}],"http://sbols.org/v3#description":[{"@value":"Toggle Switch genetic circuit - codon optimised"}],"http://sbols.org/v3#name":[{"@value":"Toggle Switch Optimised"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#displayId":[{"@value":"toggle_switch_optimised"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/codon_optimization_activity","http://www.w3.org/ns/prov#qualifiedAssociation":[{"@id":"https://sbolstandard.org/examples/codon_optimization_activity/Association1"}],"http://www.w3.org/ns/prov#endedAtTime":[{"@value":"2019-08-30T00:00:00Z"}],"@type":["http://sbols.org/v3#TopLevel","http://www.w3.org/ns/prov#Activity"],"http://sbols.org/v3#displayId":[{"@value":"codon_optimization_activity"}],"http://www.w3.org/ns/prov#qualifiedUsage":[{"@id":"https://sbolstandard.org/examples/codon_optimization_activity/Usage1"},{"@id":"https://sbolstandard.org/examples/codon_optimization_activity/Usage2"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#name":[{"@value":"Codon optimization activity"}],"http://www.w3.org/ns/prov#startedAtTime":[{"@value":"2019-07-29T16:50:59Z"}],"http://sbols.org/v3#description":[{"@value":"An activity that is used to optimise codons"}],"http://sbols.org/v3#type":[{"@id":"http://sbols.org/v3#design"}]},{"@id":"https://sbolstandard.org/examples/RBS_optimisation_activity","http://www.w3.org/ns/prov#wasInformedBy":[{"@id":"https://sbolstandard.org/examples/codon_optimization_activity"}],"http://sbols.org/v3#description":[{"@value":"An activity that is used to RBSs"}],"http://sbols.org/v3#name":[{"@value":"RBS optimization activity"}],"http://sbols.org/v3#type":[{"@id":"http://sbols.org/v3#design"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#TopLevel","http://www.w3.org/ns/prov#Activity"],"http://sbols.org/v3#displayId":[{"@value":"RBS_optimisation_activity"}]},{"@id":"https://sbolstandard.org/examples/CodonOptimiserSoftware","http://sbols.org/v3#description":[{"@value":"Used to optimise bacterial DNA sequences."}],"http://sbols.org/v3#name":[{"@value":"Codon Optimiser Software"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#TopLevel","http://www.w3.org/ns/prov#Agent"],"http://sbols.org/v3#displayId":[{"@value":"CodonOptimiserSoftware"}]},{"@id":"https://sbolstandard.org/examples/codon_optimization_activity/Association1","http://www.w3.org/ns/prov#hadRole":[{"@id":"http://sbols.org/v3#design"}],"http://www.w3.org/ns/prov#hadPlan":[{"@id":"https://sbolstandard.org/examples/CodonOptimisationProtocol"}],"http://www.w3.org/ns/prov#agent":[{"@id":"https://sbolstandard.org/examples/CodonOptimiserSoftware"}],"@type":["http://sbols.org/v3#Identified","http://www.w3.org/ns/prov#Association"],"http://sbols.org/v3#displayId":[{"@value":"Association1"}]},{"@id":"https://sbolstandard.org/examples/codon_optimization_activity/Usage2","http://www.w3.org/ns/prov#hadRole":[{"@id":"http://sbols.org/v3#design"}],"http://www.w3.org/ns/prov#entity":[{"@id":"https://sbolstandard.org/examples/toggle_switch_optimised"}],"@type":["http://sbols.org/v3#Identified","http://www.w3.org/ns/prov#Usage"],"http://sbols.org/v3#displayId":[{"@value":"Usage2"}]},{"@id":"https://sbolstandard.org/examples/CodonOptimisationProtocol","http://sbols.org/v3#description":[{"@value":"Optimisation protocol to improve the translation of mRNAs."}],"http://sbols.org/v3#name":[{"@value":"Codon Optimisation Protocol"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#TopLevel","http://www.w3.org/ns/prov#Plan"],"http://sbols.org/v3#displayId":[{"@value":"CodonOptimisationProtocol"}]}]} \ No newline at end of file diff --git a/SBOL3/provenance_entity/activity/activity.nt b/SBOL3/provenance_entity/activity/activity.nt index cd4030e..15c48d7 100644 --- a/SBOL3/provenance_entity/activity/activity.nt +++ b/SBOL3/provenance_entity/activity/activity.nt @@ -1,3 +1,14 @@ + . + . + . + "Usage1" . + . + "Toggle Switch genetic circuit" . + "Toggle Switch" . + . + . + "toggle_switch" . + . . . "Toggle Switch genetic circuit - codon optimised" . @@ -6,12 +17,6 @@ . "toggle_switch_optimised" . . - "Used to optimise bacterial DNA sequences." . - "Codon Optimiser Software" . - . - . - "CodonOptimiserSoftware" . - . . "An activity that is used to RBSs" . "RBS optimization activity" . @@ -20,43 +25,38 @@ . "RBS_optimisation_activity" . . - . - . - . - . - "Association1" . - . - "Toggle Switch genetic circuit" . - "Toggle Switch" . - . - . - "toggle_switch" . - . - . - . - . - "Usage1" . - . - . - . - . - "Usage2" . - . + "Used to optimise bacterial DNA sequences." . + "Codon Optimiser Software" . + . + . + "CodonOptimiserSoftware" . + . + . + "2019-08-30T00:00:00Z" . + . + "codon_optimization_activity" . + . + . + . + "Codon optimization activity" . + "2019-07-29T16:50:59Z" . + "An activity that is used to optimise codons" . + . + . "Optimisation protocol to improve the translation of mRNAs." . "Codon Optimisation Protocol" . . . "CodonOptimisationProtocol" . . - . - . - "Codon optimization activity" . - "An activity that is used to optimise codons" . - . - . - "codon_optimization_activity" . - "2019-07-29T16:50:59Z" . - "2019-08-30T00:00:00Z" . - . - . - . + . + . + . + "Usage2" . + . + . + . + . + . + "Association1" . + . diff --git a/SBOL3/provenance_entity/activity/activity.rdf b/SBOL3/provenance_entity/activity/activity.rdf index a8685a7..b103d1e 100644 --- a/SBOL3/provenance_entity/activity/activity.rdf +++ b/SBOL3/provenance_entity/activity/activity.rdf @@ -28,24 +28,6 @@ toggle_switch_optimised - - Used to optimise bacterial DNA sequences. - Codon Optimiser Software - - CodonOptimiserSoftware - - - - - - - An activity that is used to RBSs - RBS optimization activity - - - RBS_optimisation_activity - - Optimisation protocol to improve the translation of mRNAs. Codon Optimisation Protocol @@ -54,31 +36,19 @@ - - Codon optimization activity - An activity that is used to optimise codons - - - - - Usage2 - - - - - codon_optimization_activity - 2019-07-29T16:50:59Z - 2019-08-30T00:00:00Z - + + + Association1 - + 2019-08-30T00:00:00Z + codon_optimization_activity @@ -87,5 +57,35 @@ + + + + + Usage2 + + + + + Codon optimization activity + 2019-07-29T16:50:59Z + An activity that is used to optimise codons + + + + + Used to optimise bacterial DNA sequences. + Codon Optimiser Software + + CodonOptimiserSoftware + + + + + An activity that is used to RBSs + RBS optimization activity + + + RBS_optimisation_activity + diff --git a/SBOL3/provenance_entity/activity/activity.rj b/SBOL3/provenance_entity/activity/activity.rj index 4bcbcef..8ee0150 100644 --- a/SBOL3/provenance_entity/activity/activity.rj +++ b/SBOL3/provenance_entity/activity/activity.rj @@ -1,17 +1,13 @@ { - "https://sbolstandard.org/examples/CodonOptimiserSoftware" : { + "https://sbolstandard.org/examples/CodonOptimisationProtocol" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "CodonOptimiserSoftware" + "value" : "CodonOptimisationProtocol" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" - } - , { - "type" : "uri" , - "value" : "http://www.w3.org/ns/prov#Agent" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Optimisation protocol to improve the translation of mRNAs." } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -21,34 +17,43 @@ ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Codon Optimiser Software" + "value" : "Codon Optimisation Protocol" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Used to optimise bacterial DNA sequences." + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" + } + , { + "type" : "uri" , + "value" : "http://www.w3.org/ns/prov#Plan" } ] } , - "https://sbolstandard.org/examples/RBS_optimisation_activity" : { - "http://sbols.org/v3#displayId" : [ { + "https://sbolstandard.org/examples/codon_optimization_activity" : { + "http://www.w3.org/ns/prov#endedAtTime" : [ { "type" : "literal" , - "value" : "RBS_optimisation_activity" + "value" : "2019-08-30T00:00:00Z" } ] , - "http://www.w3.org/ns/prov#wasInformedBy" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/codon_optimization_activity" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "codon_optimization_activity" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://www.w3.org/ns/prov#qualifiedUsage" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "value" : "https://sbolstandard.org/examples/codon_optimization_activity/Usage2" } , { "type" : "uri" , - "value" : "http://www.w3.org/ns/prov#Activity" + "value" : "https://sbolstandard.org/examples/codon_optimization_activity/Usage1" + } + ] , + "http://www.w3.org/ns/prov#startedAtTime" : [ { + "type" : "literal" , + "value" : "2019-07-29T16:50:59Z" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -56,111 +61,100 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "RBS optimization activity" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "An activity that is used to RBSs" + "value" : "An activity that is used to optimise codons" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#design" - } - ] - } - , - "https://sbolstandard.org/examples/toggle_switch" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "toggle_switch" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://www.w3.org/ns/prov#qualifiedAssociation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://sbolstandard.org/examples/codon_optimization_activity/Association1" } ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Toggle Switch" + "value" : "Codon optimization activity" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Toggle Switch genetic circuit" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" } - ] , - "http://sbols.org/v3#type" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "http://www.w3.org/ns/prov#Activity" } ] } , - "https://sbolstandard.org/examples/CodonOptimisationProtocol" : { + "https://sbolstandard.org/examples/codon_optimization_activity/Usage2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "CodonOptimisationProtocol" + "value" : "Usage2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://www.w3.org/ns/prov#Plan" - } - , { + "http://www.w3.org/ns/prov#hadRole" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "value" : "http://sbols.org/v3#design" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://www.w3.org/ns/prov#entity" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://sbolstandard.org/examples/toggle_switch_optimised" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "Codon Optimisation Protocol" + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Identified" } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Optimisation protocol to improve the translation of mRNAs." + , { + "type" : "uri" , + "value" : "http://www.w3.org/ns/prov#Usage" } ] } , - "https://sbolstandard.org/examples/codon_optimization_activity" : { + "https://sbolstandard.org/examples/codon_optimization_activity/Usage1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "codon_optimization_activity" + "value" : "Usage1" } ] , - "http://www.w3.org/ns/prov#endedAtTime" : [ { - "type" : "literal" , - "value" : "2019-08-30T00:00:00Z" + "http://www.w3.org/ns/prov#hadRole" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#learn" + } + ] , + "http://www.w3.org/ns/prov#entity" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "value" : "http://sbols.org/v3#Identified" } , { "type" : "uri" , - "value" : "http://www.w3.org/ns/prov#Activity" + "value" : "http://www.w3.org/ns/prov#Usage" + } + ] + } + , + "https://sbolstandard.org/examples/CodonOptimiserSoftware" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "CodonOptimiserSoftware" } ] , - "http://www.w3.org/ns/prov#startedAtTime" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "2019-07-29T16:50:59Z" + "value" : "Used to optimise bacterial DNA sequences." } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -170,31 +164,49 @@ ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Codon optimization activity" + "value" : "Codon Optimiser Software" } ] , - "http://www.w3.org/ns/prov#qualifiedUsage" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/codon_optimization_activity/Usage1" + "value" : "http://sbols.org/v3#TopLevel" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/codon_optimization_activity/Usage2" + "value" : "http://www.w3.org/ns/prov#Agent" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "toggle_switch" } ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "An activity that is used to optimise codons" + "value" : "Toggle Switch genetic circuit" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#design" + "value" : "https://identifiers.org/SBO:0000241" } ] , - "http://www.w3.org/ns/prov#qualifiedAssociation" : [ { + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Toggle Switch" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/codon_optimization_activity/Association1" + "value" : "http://sbols.org/v3#Component" } ] } @@ -205,19 +217,24 @@ "value" : "toggle_switch_optimised" } ] , - "http://www.w3.org/ns/prov#wasGeneratedBy" : [ { + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Toggle Switch genetic circuit - codon optimised" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/codon_optimization_activity" + "value" : "https://sbolstandard.org/examples" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://www.w3.org/ns/prov#wasDerivedFrom" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/toggle_switch" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://identifiers.org/SBO:0000241" } ] , "http://sbols.org/v3#name" : [ { @@ -225,19 +242,14 @@ "value" : "Toggle Switch Optimised" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Toggle Switch genetic circuit - codon optimised" - } - ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/ns/prov#wasGeneratedBy" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "https://sbolstandard.org/examples/codon_optimization_activity" } ] , - "http://www.w3.org/ns/prov#wasDerivedFrom" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch" + "value" : "http://sbols.org/v3#Component" } ] } @@ -248,82 +260,70 @@ "value" : "Association1" } ] , - "http://www.w3.org/ns/prov#agent" : [ { + "http://www.w3.org/ns/prov#hadRole" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/CodonOptimiserSoftware" + "value" : "http://sbols.org/v3#design" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://www.w3.org/ns/prov#agent" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Identified" + "value" : "https://sbolstandard.org/examples/CodonOptimiserSoftware" } - , { + ] , + "http://www.w3.org/ns/prov#hadPlan" : [ { "type" : "uri" , - "value" : "http://www.w3.org/ns/prov#Association" + "value" : "https://sbolstandard.org/examples/CodonOptimisationProtocol" } ] , - "http://www.w3.org/ns/prov#hadRole" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#design" + "value" : "http://www.w3.org/ns/prov#Association" } - ] , - "http://www.w3.org/ns/prov#hadPlan" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/CodonOptimisationProtocol" + "value" : "http://sbols.org/v3#Identified" } ] } , - "https://sbolstandard.org/examples/codon_optimization_activity/Usage1" : { + "https://sbolstandard.org/examples/RBS_optimisation_activity" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Usage1" + "value" : "RBS_optimisation_activity" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Identified" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "An activity that is used to RBSs" } - , { + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://www.w3.org/ns/prov#Usage" + "value" : "https://sbolstandard.org/examples" } ] , - "http://www.w3.org/ns/prov#entity" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch" + "value" : "http://sbols.org/v3#design" } ] , - "http://www.w3.org/ns/prov#hadRole" : [ { + "http://www.w3.org/ns/prov#wasInformedBy" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#learn" + "value" : "https://sbolstandard.org/examples/codon_optimization_activity" } - ] - } - , - "https://sbolstandard.org/examples/codon_optimization_activity/Usage2" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Usage2" + "value" : "RBS optimization activity" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Identified" + "value" : "http://sbols.org/v3#TopLevel" } , { "type" : "uri" , - "value" : "http://www.w3.org/ns/prov#Usage" - } - ] , - "http://www.w3.org/ns/prov#entity" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch_optimised" - } - ] , - "http://www.w3.org/ns/prov#hadRole" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#design" + "value" : "http://www.w3.org/ns/prov#Activity" } ] } diff --git a/SBOL3/provenance_entity/activity/activity.ttl b/SBOL3/provenance_entity/activity/activity.ttl index 9515ea2..997ab3e 100644 --- a/SBOL3/provenance_entity/activity/activity.ttl +++ b/SBOL3/provenance_entity/activity/activity.ttl @@ -1,81 +1,81 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + + + a sbol:Identified , prov:Usage; + sbol:displayId "Usage1"; + prov:entity :toggle_switch; + prov:hadRole sbol:learn . + +:toggle_switch a sbol:Component; + sbol:description "Toggle Switch genetic circuit"; + sbol:displayId "toggle_switch"; + sbol:hasNamespace ; + sbol:name "Toggle Switch"; + sbol:type SBO:0000241 . :toggle_switch_optimised - a sbol:Component ; - sbol:description "Toggle Switch genetic circuit - codon optimised" ; - sbol:displayId "toggle_switch_optimised" ; - sbol:hasNamespace ; - sbol:name "Toggle Switch Optimised" ; - sbol:type SBO:0000241 ; - prov:wasDerivedFrom :toggle_switch ; + a sbol:Component; + sbol:description "Toggle Switch genetic circuit - codon optimised"; + sbol:displayId "toggle_switch_optimised"; + sbol:hasNamespace ; + sbol:name "Toggle Switch Optimised"; + sbol:type SBO:0000241; + prov:wasDerivedFrom :toggle_switch; prov:wasGeneratedBy :codon_optimization_activity . -:CodonOptimiserSoftware - a sbol:TopLevel , prov:Agent ; - sbol:description "Used to optimise bacterial DNA sequences." ; - sbol:displayId "CodonOptimiserSoftware" ; - sbol:hasNamespace ; - sbol:name "Codon Optimiser Software" . - :RBS_optimisation_activity - a sbol:TopLevel , prov:Activity ; - sbol:description "An activity that is used to RBSs" ; - sbol:displayId "RBS_optimisation_activity" ; - sbol:hasNamespace ; - sbol:name "RBS optimization activity" ; - sbol:type sbol:design ; + a sbol:TopLevel , prov:Activity; + sbol:description "An activity that is used to RBSs"; + sbol:displayId "RBS_optimisation_activity"; + sbol:hasNamespace ; + sbol:name "RBS optimization activity"; + sbol:type sbol:design; prov:wasInformedBy :codon_optimization_activity . - - a sbol:Identified , prov:Association ; - sbol:displayId "Association1" ; - prov:agent :CodonOptimiserSoftware ; - prov:hadPlan :CodonOptimisationProtocol ; - prov:hadRole sbol:design . +:CodonOptimiserSoftware + a sbol:TopLevel , prov:Agent; + sbol:description "Used to optimise bacterial DNA sequences."; + sbol:displayId "CodonOptimiserSoftware"; + sbol:hasNamespace ; + sbol:name "Codon Optimiser Software" . -:toggle_switch a sbol:Component ; - sbol:description "Toggle Switch genetic circuit" ; - sbol:displayId "toggle_switch" ; - sbol:hasNamespace ; - sbol:name "Toggle Switch" ; - sbol:type SBO:0000241 . +:codon_optimization_activity + a sbol:TopLevel , prov:Activity; + sbol:description "An activity that is used to optimise codons"; + sbol:displayId "codon_optimization_activity"; + sbol:hasNamespace ; + sbol:name "Codon optimization activity"; + sbol:type sbol:design; + prov:endedAtTime "2019-08-30T00:00:00Z"; + prov:qualifiedAssociation ; + prov:qualifiedUsage , ; + prov:startedAtTime "2019-07-29T16:50:59Z" . - - a sbol:Identified , prov:Usage ; - sbol:displayId "Usage1" ; - prov:entity :toggle_switch ; - prov:hadRole sbol:learn . +:CodonOptimisationProtocol + a sbol:TopLevel , prov:Plan; + sbol:description "Optimisation protocol to improve the translation of mRNAs."; + sbol:displayId "CodonOptimisationProtocol"; + sbol:hasNamespace ; + sbol:name "Codon Optimisation Protocol" . - a sbol:Identified , prov:Usage ; - sbol:displayId "Usage2" ; - prov:entity :toggle_switch_optimised ; + a sbol:Identified , prov:Usage; + sbol:displayId "Usage2"; + prov:entity :toggle_switch_optimised; prov:hadRole sbol:design . -:CodonOptimisationProtocol - a sbol:TopLevel , prov:Plan ; - sbol:description "Optimisation protocol to improve the translation of mRNAs." ; - sbol:displayId "CodonOptimisationProtocol" ; - sbol:hasNamespace ; - sbol:name "Codon Optimisation Protocol" . - -:codon_optimization_activity - a sbol:TopLevel , prov:Activity ; - sbol:description "An activity that is used to optimise codons" ; - sbol:displayId "codon_optimization_activity" ; - sbol:hasNamespace ; - sbol:name "Codon optimization activity" ; - sbol:type sbol:design ; - prov:endedAtTime "2019-08-30T00:00:00Z" ; - prov:qualifiedAssociation ; - prov:qualifiedUsage , ; - prov:startedAtTime "2019-07-29T16:50:59Z" . + + a sbol:Identified , prov:Association; + sbol:displayId "Association1"; + prov:agent :CodonOptimiserSoftware; + prov:hadPlan :CodonOptimisationProtocol; + prov:hadRole sbol:design . diff --git a/SBOL3/provenance_entity/agent/agent.jsonld_expanded b/SBOL3/provenance_entity/agent/agent.jsonld_expanded index d5e2cb2..8407ecb 100644 --- a/SBOL3/provenance_entity/agent/agent.jsonld_expanded +++ b/SBOL3/provenance_entity/agent/agent.jsonld_expanded @@ -1,34 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/CodonOptimiserSoftware", - "http://sbols.org/v3#description" : [ { - "@value" : "Used to optimise bacterial DNA sequences." - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "Codon Optimiser Software" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.w3.org/ns/prov#Agent" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "CodonOptimiserSoftware" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch", - "http://sbols.org/v3#description" : [ { - "@value" : "Toggle Switch genetic circuit" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "Toggle Switch" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000241" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "toggle_switch" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/toggle_switch","http://sbols.org/v3#description":[{"@value":"Toggle Switch genetic circuit"}],"http://sbols.org/v3#name":[{"@value":"Toggle Switch"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000241"}],"http://sbols.org/v3#displayId":[{"@value":"toggle_switch"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/CodonOptimiserSoftware","http://sbols.org/v3#description":[{"@value":"Used to optimise bacterial DNA sequences."}],"http://sbols.org/v3#name":[{"@value":"Codon Optimiser Software"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#TopLevel","http://www.w3.org/ns/prov#Agent"],"http://sbols.org/v3#displayId":[{"@value":"CodonOptimiserSoftware"}]}]} \ No newline at end of file diff --git a/SBOL3/provenance_entity/agent/agent.rj b/SBOL3/provenance_entity/agent/agent.rj index 711b91f..cae315f 100644 --- a/SBOL3/provenance_entity/agent/agent.rj +++ b/SBOL3/provenance_entity/agent/agent.rj @@ -5,13 +5,9 @@ "value" : "CodonOptimiserSoftware" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" - } - , { - "type" : "uri" , - "value" : "http://www.w3.org/ns/prov#Agent" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Used to optimise bacterial DNA sequences." } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -24,9 +20,13 @@ "value" : "Codon Optimiser Software" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Used to optimise bacterial DNA sequences." + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" + } + , { + "type" : "uri" , + "value" : "http://www.w3.org/ns/prov#Agent" } ] } @@ -37,9 +37,9 @@ "value" : "toggle_switch" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Toggle Switch genetic circuit" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -47,19 +47,19 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "Toggle Switch" + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000241" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Toggle Switch genetic circuit" + "value" : "Toggle Switch" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000241" + "value" : "http://sbols.org/v3#Component" } ] } diff --git a/SBOL3/provenance_entity/agent/agent.ttl b/SBOL3/provenance_entity/agent/agent.ttl index da34eaf..8d23e77 100644 --- a/SBOL3/provenance_entity/agent/agent.ttl +++ b/SBOL3/provenance_entity/agent/agent.ttl @@ -1,24 +1,24 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: -:toggle_switch a sbol:Component ; - sbol:description "Toggle Switch genetic circuit" ; - sbol:displayId "toggle_switch" ; - sbol:hasNamespace ; - sbol:name "Toggle Switch" ; +:toggle_switch a sbol:Component; + sbol:description "Toggle Switch genetic circuit"; + sbol:displayId "toggle_switch"; + sbol:hasNamespace ; + sbol:name "Toggle Switch"; sbol:type SBO:0000241 . :CodonOptimiserSoftware - a sbol:TopLevel , prov:Agent ; - sbol:description "Used to optimise bacterial DNA sequences." ; - sbol:displayId "CodonOptimiserSoftware" ; - sbol:hasNamespace ; + a sbol:TopLevel , prov:Agent; + sbol:description "Used to optimise bacterial DNA sequences."; + sbol:displayId "CodonOptimiserSoftware"; + sbol:hasNamespace ; sbol:name "Codon Optimiser Software" . diff --git a/SBOL3/provenance_entity/plan/plan.jsonld_expanded b/SBOL3/provenance_entity/plan/plan.jsonld_expanded index 117fd7d..ffff8b8 100644 --- a/SBOL3/provenance_entity/plan/plan.jsonld_expanded +++ b/SBOL3/provenance_entity/plan/plan.jsonld_expanded @@ -1,16 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/CodonOptimisationProtocol", - "http://sbols.org/v3#description" : [ { - "@value" : "Optimisation protocol to improve the translation of mRNAs." - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "Codon Optimisation Protocol" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#TopLevel", "http://www.w3.org/ns/prov#Plan" ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "CodonOptimisationProtocol" - } ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/CodonOptimisationProtocol","http://sbols.org/v3#description":[{"@value":"Optimisation protocol to improve the translation of mRNAs."}],"http://sbols.org/v3#name":[{"@value":"Codon Optimisation Protocol"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#TopLevel","http://www.w3.org/ns/prov#Plan"],"http://sbols.org/v3#displayId":[{"@value":"CodonOptimisationProtocol"}]}]} \ No newline at end of file diff --git a/SBOL3/provenance_entity/plan/plan.rj b/SBOL3/provenance_entity/plan/plan.rj index aa32c6a..f98fad6 100644 --- a/SBOL3/provenance_entity/plan/plan.rj +++ b/SBOL3/provenance_entity/plan/plan.rj @@ -5,13 +5,9 @@ "value" : "CodonOptimisationProtocol" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://www.w3.org/ns/prov#Plan" - } - , { - "type" : "uri" , - "value" : "http://sbols.org/v3#TopLevel" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Optimisation protocol to improve the translation of mRNAs." } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -24,9 +20,13 @@ "value" : "Codon Optimisation Protocol" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Optimisation protocol to improve the translation of mRNAs." + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#TopLevel" + } + , { + "type" : "uri" , + "value" : "http://www.w3.org/ns/prov#Plan" } ] } diff --git a/SBOL3/provenance_entity/plan/plan.ttl b/SBOL3/provenance_entity/plan/plan.ttl index 47af01a..6c9c82c 100644 --- a/SBOL3/provenance_entity/plan/plan.ttl +++ b/SBOL3/provenance_entity/plan/plan.ttl @@ -1,17 +1,17 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: :CodonOptimisationProtocol - a sbol:TopLevel , prov:Plan ; - sbol:description "Optimisation protocol to improve the translation of mRNAs." ; - sbol:displayId "CodonOptimisationProtocol" ; - sbol:hasNamespace ; + a sbol:TopLevel , prov:Plan; + sbol:description "Optimisation protocol to improve the translation of mRNAs."; + sbol:displayId "CodonOptimisationProtocol"; + sbol:hasNamespace ; sbol:name "Codon Optimisation Protocol" . diff --git a/SBOL3/toggle_switch/toggle_switch.jsonld b/SBOL3/toggle_switch/toggle_switch.jsonld index 070dac7..aabf493 100644 --- a/SBOL3/toggle_switch/toggle_switch.jsonld +++ b/SBOL3/toggle_switch/toggle_switch.jsonld @@ -1,774 +1,847 @@ { "@graph": [ { - "@id": "https://sbolstandard.org/examples/lacI", - "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:role": { - "@id": "SO:0000316" - }, - "sbol:name": "lacI", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent6", + "sbol:orientation": { + "@id": "SO:0001030" }, - "sbol:displayId": "lacI", - "sbol:description": "lacI coding sequence", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/LacI_protein" + "@id": "https://sbolstandard.org/examples/ter_lacI" }, "sbol:displayId": "SubComponent6", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/LacI_protein", - "sbol:type": { - "@id": "SBO:0000252" - }, - "sbol:role": { - "@id": "GO:0003700" - }, - "sbol:name": "LacI", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "LacI_protein", - "sbol:description": "LacI protein", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/ter_tetR", + "@id": "https://sbolstandard.org/examples/ter_lacI", "sbol:type": { "@id": "SBO:0000251" }, "sbol:role": { "@id": "SO:0000141" }, - "sbol:name": "tetR terminator", + "sbol:name": "lacI terminator", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "ter_tetR", + "sbol:displayId": "ter_lacI", "sbol:description": "Terminator", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/IPTG_LacI", - "sbol:type": { - "@id": "SBO:0000253" - }, - "sbol:name": "IPTG_LacI", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "IPTG_LacI", - "sbol:description": "IPTG_LacI complex", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint2", + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint1", "sbol:subject": { - "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" }, "sbol:restriction": { "@id": "sbol:verifyIdentical" }, "sbol:object": { - "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" }, - "sbol:displayId": "Constraint2", + "sbol:displayId": "Constraint1", "@type": "sbol:Constraint" }, { - "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference3", + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference1", "sbol:refersTo": { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7" }, "sbol:inChildOf": { "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1" }, - "sbol:displayId": "ComponentReference3", + "sbol:displayId": "ComponentReference1", "@type": "sbol:ComponentReference" }, { - "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference4", + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference2", "sbol:refersTo": { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" }, "sbol:inChildOf": { "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2" }, - "sbol:displayId": "ComponentReference4", + "sbol:displayId": "ComponentReference2", "@type": "sbol:ComponentReference" }, { - "@id": "https://sbolstandard.org/examples/ter_lacI", - "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:role": { - "@id": "SO:0000141" - }, - "sbol:name": "lacI terminator", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "ter_lacI", - "sbol:description": "Terminator", - "@type": "sbol:Component" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent6", - "sbol:orientation": { - "@id": "SO:0001030" - }, + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/ter_lacI" + "@id": "https://sbolstandard.org/examples/LacI_protein" }, "sbol:displayId": "SubComponent6", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/IPTG", + "@id": "https://sbolstandard.org/examples/LacI_protein", "sbol:type": { - "@id": "SBO:0000247" + "@id": "SBO:0000252" }, "sbol:role": { - "@id": "CHEBI:35224" + "@id": "GO:0003700" }, - "sbol:name": "IPTG", + "sbol:name": "LacI", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "IPTG", - "sbol:description": "IPTG", + "sbol:displayId": "LacI_protein", + "sbol:description": "LacI protein", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1", + "@id": "https://sbolstandard.org/examples/LacI_producer", + "sbol:hasInteraction": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2" + } + ], "sbol:role": { - "@id": "SBO:0000642" + "@id": "SO:0000704" }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent1" + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent10" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent11" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent4" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent5" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent6" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2" + } + ], + "@type": "sbol:Component", + "sbol:name": "LacI producer", + "sbol:displayId": "LacI_producer", + "sbol:type": { + "@id": "SBO:0000251" }, - "sbol:displayId": "Participation1", - "@type": "sbol:Participation" + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:description": "LacI producer" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent1", - "sbol:orientation": { - "@id": "SO:0001030" + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3", + "sbol:type": { + "@id": "SBO:0000169" }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2" + } + ], + "sbol:displayId": "Interaction3", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent10", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/pLacI" + "@id": "https://sbolstandard.org/examples/aTC" }, - "sbol:displayId": "SubComponent1", + "sbol:displayId": "SubComponent10", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1", - "sbol:role": { - "@id": "SBO:0000010" - }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LacI_protein" }, - "sbol:displayId": "Participation1", - "@type": "sbol:Participation" + "sbol:displayId": "SubComponent7", + "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/pTetR", - "sbol:type": { - "@id": "SBO:0000251" - }, - "sbol:role": { - "@id": "SO:0000167" + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3", + "sbol:orientation": { + "@id": "SO:0001030" }, - "sbol:name": "pTetR", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/lacI" }, - "sbol:displayId": "pTetR", - "sbol:description": "TetR repressible promoter", - "@type": "sbol:Component" + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/rbs_gfp", + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4", "sbol:type": { - "@id": "SBO:0000251" + "@id": "SBO:0000177" }, - "sbol:role": { - "@id": "SO:0000139" + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" + } + ], + "sbol:displayId": "Interaction4", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent11", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/atC_TetR" }, - "sbol:name": "rbs", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" + "sbol:displayId": "SubComponent11", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent8", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/GFP_protein" }, - "sbol:displayId": "rbs_gfp", - "sbol:description": "RBS", - "@type": "sbol:Component" + "sbol:displayId": "SubComponent8", + "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5", + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9", "sbol:instanceOf": { "@id": "https://sbolstandard.org/examples/TetR_protein" }, - "sbol:displayId": "SubComponent5", + "sbol:displayId": "SubComponent9", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/TetR_protein", - "sbol:type": { - "@id": "SBO:0000252" - }, - "sbol:role": { - "@id": "GO:0003700" + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent4", + "sbol:orientation": { + "@id": "SO:0001030" }, - "sbol:name": "TetR", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_gfp" }, - "sbol:displayId": "TetR_protein", - "sbol:description": "TetR protein", - "@type": "sbol:Component" + "sbol:displayId": "SubComponent4", + "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent11", + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent5", + "sbol:orientation": { + "@id": "SO:0001030" + }, "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/atC_TetR" + "@id": "https://sbolstandard.org/examples/gfp" }, - "sbol:displayId": "SubComponent11", + "sbol:displayId": "SubComponent5", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/atC_TetR", + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1", "sbol:type": { - "@id": "SBO:0000253" + "@id": "SBO:0000589" }, - "sbol:name": "atC_TetR", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2" + } + ], + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1", + "sbol:orientation": { + "@id": "SO:0001030" }, - "sbol:displayId": "atC_TetR", - "sbol:description": "atC_TetR complex", - "@type": "sbol:Component" + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/pTetR" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4", + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2", "sbol:type": { - "@id": "SBO:0000177" + "@id": "SBO:0000589" }, "sbol:hasParticipation": [ { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1" + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2" + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2" + } + ], + "sbol:displayId": "Interaction2", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_lacI" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" } ], - "sbol:displayId": "Interaction4", + "sbol:displayId": "Interaction1", "@type": "sbol:Interaction" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1", + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1", "sbol:role": { - "@id": "SBO:0000010" + "@id": "SBO:0000645" }, "sbol:participant": { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent3" }, "sbol:displayId": "Participation1", "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2", + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2", "sbol:role": { - "@id": "SBO:0000010" + "@id": "SBO:0000011" }, "sbol:participant": { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent10" + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5" }, "sbol:displayId": "Participation2", "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3", + "@id": "https://sbolstandard.org/examples/gfp", + "sbol:type": { + "@id": "SBO:0000251" + }, "sbol:role": { - "@id": "SBO:0000011" + "@id": "SO:0000316" }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent11" + "sbol:name": "gfp", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "Participation3", - "@type": "sbol:Participation" + "sbol:displayId": "gfp", + "sbol:description": "gfp coding sequence", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint1", - "sbol:subject": { - "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference3", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" }, - "sbol:restriction": { - "@id": "sbol:verifyIdentical" + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1" }, - "sbol:object": { - "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" + "sbol:displayId": "ComponentReference3", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LacI_producer" }, - "sbol:displayId": "Constraint1", - "@type": "sbol:Constraint" + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference1", - "sbol:refersTo": { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + "@id": "https://sbolstandard.org/examples/atC_TetR", + "sbol:type": { + "@id": "SBO:0000253" }, - "sbol:inChildOf": { - "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + "sbol:name": "atC_TetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "ComponentReference1", - "@type": "sbol:ComponentReference" + "sbol:displayId": "atC_TetR", + "sbol:description": "atC_TetR complex", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference2", - "sbol:refersTo": { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + "@id": "https://sbolstandard.org/examples/pTetR", + "sbol:type": { + "@id": "SBO:0000251" }, - "sbol:inChildOf": { - "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + "sbol:role": { + "@id": "SO:0000167" }, - "sbol:displayId": "ComponentReference2", - "@type": "sbol:ComponentReference" + "sbol:name": "pTetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "pTetR", + "sbol:description": "TetR repressible promoter", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent5", + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent1", "sbol:orientation": { "@id": "SO:0001030" }, "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/gfp" + "@id": "https://sbolstandard.org/examples/pLacI" }, - "sbol:displayId": "SubComponent5", + "sbol:displayId": "SubComponent1", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/gfp", + "@id": "https://sbolstandard.org/examples/pLacI", "sbol:type": { "@id": "SBO:0000251" }, "sbol:role": { - "@id": "SO:0000316" + "@id": "SO:0000167" }, - "sbol:name": "gfp", + "sbol:name": "pLacI promoter", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "gfp", - "sbol:description": "gfp coding sequence", + "sbol:displayId": "pLacI", + "sbol:description": "LacI repressible promoter", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/TetR_producer" + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2", + "sbol:role": { + "@id": "SBO:0000011" }, - "sbol:displayId": "SubComponent2", - "@type": "sbol:SubComponent" + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent4", - "sbol:orientation": { - "@id": "SO:0001030" + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1", + "sbol:role": { + "@id": "SBO:0000642" }, - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/ter_tetR" + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent1" }, - "sbol:displayId": "SubComponent4", - "@type": "sbol:SubComponent" + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3", + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1", + "sbol:role": { + "@id": "SBO:0000642" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/GFP_protein", "sbol:type": { - "@id": "SBO:0000177" + "@id": "SBO:0000252" }, - "sbol:hasParticipation": [ - { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1" - }, - { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2" - }, - { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3" - } - ], - "sbol:displayId": "Interaction3", - "@type": "sbol:Interaction" + "sbol:name": "GFP", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "GFP_protein", + "sbol:description": "GFP", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2", + "@id": "https://sbolstandard.org/examples/rbs_gfp", + "sbol:type": { + "@id": "SBO:0000251" + }, "sbol:role": { - "@id": "SBO:0000010" + "@id": "SO:0000139" }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent7" + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "Participation2", - "@type": "sbol:Participation" + "sbol:displayId": "rbs_gfp", + "sbol:description": "RBS", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3", + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2", "sbol:role": { - "@id": "SBO:0000011" + "@id": "SBO:0000020" }, "sbol:participant": { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent8" + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" }, - "sbol:displayId": "Participation3", + "sbol:displayId": "Participation2", "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent10", + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent8", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/aTC" + "@id": "https://sbolstandard.org/examples/IPTG_LacI" }, - "sbol:displayId": "SubComponent10", + "sbol:displayId": "SubComponent8", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/aTC", + "@id": "https://sbolstandard.org/examples/IPTG_LacI", "sbol:type": { - "@id": "SBO:0000247" + "@id": "SBO:0000253" + }, + "sbol:name": "IPTG_LacI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "IPTG_LacI", + "sbol:description": "IPTG_LacI complex", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/rbs_tetR", + "sbol:type": { + "@id": "SBO:0000251" }, "sbol:role": { - "@id": "CHEBI:35224" + "@id": "SO:0000139" }, - "sbol:name": "aTC", + "sbol:name": "rbs", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "aTC", - "sbol:description": "aTC", + "sbol:displayId": "rbs_tetR", + "sbol:description": "tetR RBS", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3", + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3", "sbol:type": { - "@id": "SBO:0000169" + "@id": "SBO:0000177" }, "sbol:hasParticipation": [ { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1" + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2" + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3" } ], "sbol:displayId": "Interaction3", "@type": "sbol:Interaction" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1", + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1", "sbol:role": { - "@id": "SBO:0000642" + "@id": "SBO:0000010" }, "sbol:participant": { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" }, "sbol:displayId": "Participation1", "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2", + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2", "sbol:role": { - "@id": "SBO:0000020" + "@id": "SBO:0000010" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent7" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3", + "sbol:role": { + "@id": "SBO:0000011" }, "sbol:participant": { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent8" }, - "sbol:displayId": "Participation2", + "sbol:displayId": "Participation3", "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/toggle_switch", + "@id": "https://sbolstandard.org/examples/ter_tetR", "sbol:type": { "@id": "SBO:0000251" }, - "sbol:hasFeature": [ - { - "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1" - }, - { - "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" - }, - { - "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" - }, - { - "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" - }, - { - "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" - }, - { - "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2" - } - ], + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "tetR terminator", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "toggle_switch", - "sbol:description": "Toggle Switch genetic circuit", - "sbol:role": { - "@id": "SO:0000704" - }, - "sbol:hasConstraint": [ - { - "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint1" - }, - { - "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint2" - } - ], - "@type": "sbol:Component", - "sbol:name": "Toggle Switch" + "sbol:displayId": "ter_tetR", + "sbol:description": "Terminator", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/LacI_producer" + "@id": "https://sbolstandard.org/examples/lacI", + "sbol:type": { + "@id": "SBO:0000251" }, - "sbol:displayId": "SubComponent1", - "@type": "sbol:SubComponent" + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:name": "lacI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "lacI", + "sbol:description": "lacI coding sequence", + "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent4", + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent3", "sbol:orientation": { "@id": "SO:0001030" }, "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/rbs_gfp" + "@id": "https://sbolstandard.org/examples/tetR" }, - "sbol:displayId": "SubComponent4", + "sbol:displayId": "SubComponent3", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/pLacI", + "@id": "https://sbolstandard.org/examples/tetR", "sbol:type": { "@id": "SBO:0000251" }, "sbol:role": { - "@id": "SO:0000167" + "@id": "SO:0000316" }, - "sbol:name": "pLacI promoter", + "sbol:name": "tetR", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "pLacI", - "sbol:description": "LacI repressible promoter", + "sbol:displayId": "tetR", + "sbol:description": "tetR coding sequence", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/TetR_protein" - }, - "sbol:displayId": "SubComponent9", - "@type": "sbol:SubComponent" - }, - { - "@id": "https://sbolstandard.org/examples/rbs_tetR", + "@id": "https://sbolstandard.org/examples/TetR_protein", "sbol:type": { - "@id": "SBO:0000251" + "@id": "SBO:0000252" }, "sbol:role": { - "@id": "SO:0000139" + "@id": "GO:0003700" }, - "sbol:name": "rbs", + "sbol:name": "TetR", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "rbs_tetR", - "sbol:description": "tetR RBS", + "sbol:displayId": "TetR_protein", + "sbol:description": "TetR protein", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer", - "sbol:hasInteraction": [ - { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4" - } - ], + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch", + "sbol:displayId": "toggle_switch", "sbol:hasFeature": [ { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent11" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent5" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent10" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent6" + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent4" + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1" } ], - "@type": "sbol:Component", - "sbol:description": "LacI producer", - "sbol:displayId": "LacI_producer", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:name": "LacI producer", "sbol:role": { "@id": "SO:0000704" }, + "@type": "sbol:Component", + "sbol:name": "Toggle Switch", + "sbol:hasConstraint": [ + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint1" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint2" + } + ], "sbol:type": { "@id": "SBO:0000251" + }, + "sbol:description": "Toggle Switch genetic circuit", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" } }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1", - "sbol:orientation": { - "@id": "SO:0001030" + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference4", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2" }, + "sbol:displayId": "ComponentReference4", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/pTetR" + "@id": "https://sbolstandard.org/examples/TetR_producer" }, - "sbol:displayId": "SubComponent1", + "sbol:displayId": "SubComponent2", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2", - "sbol:type": { - "@id": "SBO:0000589" + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint2", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" }, - "sbol:hasParticipation": [ - { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2" - } - ], - "sbol:displayId": "Interaction2", - "@type": "sbol:Interaction" + "sbol:restriction": { + "@id": "sbol:verifyIdentical" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" + }, + "sbol:displayId": "Constraint2", + "@type": "sbol:Constraint" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2", - "sbol:orientation": { - "@id": "SO:0001030" + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1", + "sbol:role": { + "@id": "SBO:0000010" }, - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/rbs_lacI" + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" }, - "sbol:displayId": "SubComponent2", - "@type": "sbol:SubComponent" + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent8", + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/GFP_protein" + "@id": "https://sbolstandard.org/examples/TetR_protein" }, - "sbol:displayId": "SubComponent8", + "sbol:displayId": "SubComponent5", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1", - "sbol:type": { - "@id": "SBO:0000589" + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3", + "sbol:role": { + "@id": "SBO:0000011" }, - "sbol:hasParticipation": [ - { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2" - } - ], - "sbol:displayId": "Interaction1", - "@type": "sbol:Interaction" + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent11" + }, + "sbol:displayId": "Participation3", + "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3", - "sbol:orientation": { - "@id": "SO:0001030" + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1", + "sbol:role": { + "@id": "SBO:0000645" }, - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/lacI" + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3" }, - "sbol:displayId": "SubComponent3", - "@type": "sbol:SubComponent" + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/LacI_protein" + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1", + "sbol:role": { + "@id": "SBO:0000645" }, - "sbol:displayId": "SubComponent7", - "@type": "sbol:SubComponent" + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent5" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent3", - "sbol:orientation": { - "@id": "SO:0001030" - }, + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent7", "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/tetR" + "@id": "https://sbolstandard.org/examples/IPTG" }, - "sbol:displayId": "SubComponent3", + "sbol:displayId": "SubComponent7", "@type": "sbol:SubComponent" }, { - "@id": "https://sbolstandard.org/examples/tetR", + "@id": "https://sbolstandard.org/examples/IPTG", "sbol:type": { - "@id": "SBO:0000251" + "@id": "SBO:0000247" }, "sbol:role": { - "@id": "SO:0000316" + "@id": "CHEBI:35224" }, - "sbol:name": "tetR", + "sbol:name": "IPTG", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "tetR", - "sbol:description": "tetR coding sequence", + "sbol:displayId": "IPTG", + "sbol:description": "IPTG", "@type": "sbol:Component" }, { @@ -799,195 +872,122 @@ "@type": "sbol:Participation" }, { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2", + "@id": "https://sbolstandard.org/examples/rbs_lacI", + "sbol:type": { + "@id": "SBO:0000251" + }, "sbol:role": { - "@id": "SBO:0000011" + "@id": "SO:0000139" + }, + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "rbs_lacI", + "sbol:description": "RBS", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent2", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_tetR" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2", + "sbol:role": { + "@id": "SBO:0000010" }, "sbol:participant": { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent10" }, "sbol:displayId": "Participation2", "@type": "sbol:Participation" }, + { + "@id": "https://sbolstandard.org/examples/aTC", + "sbol:type": { + "@id": "SBO:0000247" + }, + "sbol:role": { + "@id": "CHEBI:35224" + }, + "sbol:name": "aTC", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "aTC", + "sbol:description": "aTC", + "@type": "sbol:Component" + }, { "@id": "https://sbolstandard.org/examples/TetR_producer", - "sbol:hasFeature": [ + "sbol:hasInteraction": [ { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent2" + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent7" + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3" }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2" + } + ], + "sbol:description": "TetR producer", + "sbol:hasFeature": [ { "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent3" + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent4" }, { "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent8" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent1" + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent3" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent7" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent4" - } - ], - "sbol:displayId": "TetR_producer", - "sbol:hasInteraction": [ - { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2" + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent2" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1" + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3" + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent1" } ], - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "@type": "sbol:Component", - "sbol:description": "TetR producer", - "sbol:name": "TetR device", - "sbol:type": { - "@id": "SBO:0000251" - }, + "sbol:displayId": "TetR_producer", "sbol:role": { "@id": "SO:0000704" - } - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2", - "sbol:role": { - "@id": "SBO:0000011" - }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7" - }, - "sbol:displayId": "Participation2", - "@type": "sbol:Participation" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1", - "sbol:role": { - "@id": "SBO:0000645" - }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent5" }, - "sbol:displayId": "Participation1", - "@type": "sbol:Participation" - }, - { - "@id": "https://sbolstandard.org/examples/rbs_lacI", + "sbol:name": "TetR device", "sbol:type": { "@id": "SBO:0000251" }, - "sbol:role": { - "@id": "SO:0000139" - }, - "sbol:name": "rbs", "sbol:hasNamespace": { "@id": "https://sbolstandard.org/examples" }, - "sbol:displayId": "rbs_lacI", - "sbol:description": "RBS", "@type": "sbol:Component" }, { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent2", + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent4", "sbol:orientation": { "@id": "SO:0001030" }, "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/rbs_tetR" - }, - "sbol:displayId": "SubComponent2", - "@type": "sbol:SubComponent" - }, - { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent7", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/IPTG" - }, - "sbol:displayId": "SubComponent7", - "@type": "sbol:SubComponent" - }, - { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent8", - "sbol:instanceOf": { - "@id": "https://sbolstandard.org/examples/IPTG_LacI" + "@id": "https://sbolstandard.org/examples/ter_tetR" }, - "sbol:displayId": "SubComponent8", + "sbol:displayId": "SubComponent4", "@type": "sbol:SubComponent" - }, - { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1", - "sbol:type": { - "@id": "SBO:0000589" - }, - "sbol:hasParticipation": [ - { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1" - }, - { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" - } - ], - "sbol:displayId": "Interaction1", - "@type": "sbol:Interaction" - }, - { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2", - "sbol:role": { - "@id": "SBO:0000011" - }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5" - }, - "sbol:displayId": "Participation2", - "@type": "sbol:Participation" - }, - { - "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1", - "sbol:role": { - "@id": "SBO:0000645" - }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent3" - }, - "sbol:displayId": "Participation1", - "@type": "sbol:Participation" - }, - { - "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1", - "sbol:role": { - "@id": "SBO:0000645" - }, - "sbol:participant": { - "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3" - }, - "sbol:displayId": "Participation1", - "@type": "sbol:Participation" - }, - { - "@id": "https://sbolstandard.org/examples/GFP_protein", - "sbol:type": { - "@id": "SBO:0000252" - }, - "sbol:name": "GFP", - "sbol:hasNamespace": { - "@id": "https://sbolstandard.org/examples" - }, - "sbol:displayId": "GFP_protein", - "sbol:description": "GFP", - "@type": "sbol:Component" } ], "@context": { diff --git a/SBOL3/toggle_switch/toggle_switch.jsonld_expanded b/SBOL3/toggle_switch/toggle_switch.jsonld_expanded index 55cecba..710b708 100644 --- a/SBOL3/toggle_switch/toggle_switch.jsonld_expanded +++ b/SBOL3/toggle_switch/toggle_switch.jsonld_expanded @@ -1,1077 +1 @@ -[ { - "@id" : "https://sbolstandard.org/examples/GFP_protein", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "GFP" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "GFP_protein" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "GFP" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/IPTG", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000247" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/CHEBI:35224" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "IPTG" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "IPTG" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "IPTG" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/IPTG_LacI", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000253" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "IPTG_LacI" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "IPTG_LacI" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "IPTG_LacI complex" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer", - "http://sbols.org/v3#hasInteraction" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction3" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction2" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction1" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction4" - } ], - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent5" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent10" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent8" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent6" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent4" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#description" : [ { - "@value" : "LacI producer" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "LacI_producer" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "LacI producer" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000704" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction1", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000589" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction1" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000645" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000011" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction2", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000589" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction2" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000645" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent5" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000011" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent8" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction3", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000169" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction3" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000642" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000020" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction4", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000177" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2" - }, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction4" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000010" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000010" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent10" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000011" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation3" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/pTetR" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent10", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/aTC" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent10" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/atC_TetR" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent11" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/rbs_lacI" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/lacI" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent3" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent4", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/rbs_gfp" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent4" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent5", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/gfp" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent5" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent6", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/ter_lacI" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent6" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_protein" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent7" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent8", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/GFP_protein" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent8" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_protein" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent9" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/LacI_protein", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/GO:0003700" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "LacI" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "LacI_protein" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "LacI protein" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer", - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent2" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent7" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent3" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent8" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent4" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "TetR_producer" - } ], - "http://sbols.org/v3#hasInteraction" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction2" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction1" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction3" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#description" : [ { - "@value" : "TetR producer" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "TetR device" - } ], - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000704" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction1", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000589" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction1" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000645" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent3" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000011" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction2", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000169" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction2" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000642" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000020" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction3", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000177" - } ], - "http://sbols.org/v3#hasParticipation" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2" - }, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Interaction3" - } ], - "@type" : [ "http://sbols.org/v3#Interaction" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000010" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation1" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000010" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent7" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation2" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3", - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SBO:0000011" - } ], - "http://sbols.org/v3#participant" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent8" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Participation3" - } ], - "@type" : [ "http://sbols.org/v3#Participation" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent1", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/pLacI" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent2", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/rbs_tetR" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent3", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/tetR" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent3" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent4", - "http://sbols.org/v3#orientation" : [ { - "@id" : "https://identifiers.org/SO:0001030" - } ], - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/ter_tetR" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent4" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_protein" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent5" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_protein" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent6" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent7", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/IPTG" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent7" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent8", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/IPTG_LacI" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent8" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/TetR_protein", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000252" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/GO:0003700" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "TetR" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "TetR_protein" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "TetR protein" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/aTC", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000247" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/CHEBI:35224" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "aTC" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "aTC" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "aTC" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/atC_TetR", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000253" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "atC_TetR" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "atC_TetR" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "atC_TetR complex" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/gfp", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000316" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "gfp" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "gfp" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "gfp coding sequence" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/lacI", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000316" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "lacI" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "lacI" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "lacI coding sequence" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/pLacI", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000167" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "pLacI promoter" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "pLacI" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "LacI repressible promoter" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/pTetR", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000167" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "pTetR" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "pTetR" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "TetR repressible promoter" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/rbs_gfp", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000139" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "rbs" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "rbs_gfp" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "RBS" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/rbs_lacI", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000139" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "rbs" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "rbs_lacI" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "RBS" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/rbs_tetR", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000139" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "rbs" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "rbs_tetR" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "tetR RBS" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/ter_lacI", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000141" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "lacI terminator" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ter_lacI" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Terminator" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/ter_tetR", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000141" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "tetR terminator" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ter_tetR" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Terminator" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/tetR", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000316" - } ], - "http://sbols.org/v3#name" : [ { - "@value" : "tetR" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "tetR" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "tetR coding sequence" - } ], - "@type" : [ "http://sbols.org/v3#Component" ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch", - "http://sbols.org/v3#type" : [ { - "@id" : "https://identifiers.org/SBO:0000251" - } ], - "http://sbols.org/v3#hasFeature" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2" - } ], - "http://sbols.org/v3#hasNamespace" : [ { - "@id" : "https://sbolstandard.org/examples" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "toggle_switch" - } ], - "http://sbols.org/v3#description" : [ { - "@value" : "Toggle Switch genetic circuit" - } ], - "http://sbols.org/v3#role" : [ { - "@id" : "https://identifiers.org/SO:0000704" - } ], - "http://sbols.org/v3#hasConstraint" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch/Constraint1" - }, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/Constraint2" - } ], - "@type" : [ "http://sbols.org/v3#Component" ], - "http://sbols.org/v3#name" : [ { - "@value" : "Toggle Switch" - } ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference1", - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" - } ], - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference1" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference2", - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" - } ], - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference2" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference3", - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" - } ], - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference3" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference4", - "http://sbols.org/v3#refersTo" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" - } ], - "http://sbols.org/v3#inChildOf" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "ComponentReference4" - } ], - "@type" : [ "http://sbols.org/v3#ComponentReference" ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/Constraint1", - "http://sbols.org/v3#subject" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#verifyIdentical" - } ], - "http://sbols.org/v3#object" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint1" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/Constraint2", - "http://sbols.org/v3#subject" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" - } ], - "http://sbols.org/v3#restriction" : [ { - "@id" : "http://sbols.org/v3#verifyIdentical" - } ], - "http://sbols.org/v3#object" : [ { - "@id" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "Constraint2" - } ], - "@type" : [ "http://sbols.org/v3#Constraint" ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/LacI_producer" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent1" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -}, { - "@id" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2", - "http://sbols.org/v3#instanceOf" : [ { - "@id" : "https://sbolstandard.org/examples/TetR_producer" - } ], - "http://sbols.org/v3#displayId" : [ { - "@value" : "SubComponent2" - } ], - "@type" : [ "http://sbols.org/v3#SubComponent" ] -} ] +{"@graph":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent6","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/ter_lacI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent6"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/ter_lacI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#name":[{"@value":"lacI terminator"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"ter_lacI"}],"http://sbols.org/v3#description":[{"@value":"Terminator"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/Constraint1","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#verifyIdentical"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference2"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint1"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference1","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent7"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference1"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference2","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent6"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference2"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent6","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/LacI_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent6"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_protein","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#name":[{"@value":"LacI"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"LacI_protein"}],"http://sbols.org/v3#description":[{"@value":"LacI protein"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/LacI_producer","http://sbols.org/v3#hasInteraction":[{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction3"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction2"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent10"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent7"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent3"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent11"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent8"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent9"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent4"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent5"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent6"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent2"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#name":[{"@value":"LacI producer"}],"http://sbols.org/v3#displayId":[{"@value":"LacI_producer"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#description":[{"@value":"LacI producer"}]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction3","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000169"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction3"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent10","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/aTC"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent10"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent7","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/LacI_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent7"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent3","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/lacI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000177"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction4"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent11","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/atC_TetR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent11"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent8","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/GFP_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent8"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent9","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/TetR_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent9"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent4","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/rbs_gfp"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent4"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent5","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/gfp"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent5"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction1","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction1"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/pTetR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction2","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction2"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent2","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/rbs_lacI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction1","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1"},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction1"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000645"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent5"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/gfp","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#name":[{"@value":"gfp"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"gfp"}],"http://sbols.org/v3#description":[{"@value":"gfp coding sequence"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference3","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent9"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference3"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/LacI_producer"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/atC_TetR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000253"}],"http://sbols.org/v3#name":[{"@value":"atC_TetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"atC_TetR"}],"http://sbols.org/v3#description":[{"@value":"atC_TetR complex"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/pTetR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000167"}],"http://sbols.org/v3#name":[{"@value":"pTetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"pTetR"}],"http://sbols.org/v3#description":[{"@value":"TetR repressible promoter"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/pLacI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/pLacI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000167"}],"http://sbols.org/v3#name":[{"@value":"pLacI promoter"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"pLacI"}],"http://sbols.org/v3#description":[{"@value":"LacI repressible promoter"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent7"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000642"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000642"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/GFP_protein","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#name":[{"@value":"GFP"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"GFP_protein"}],"http://sbols.org/v3#description":[{"@value":"GFP"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/rbs_gfp","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000139"}],"http://sbols.org/v3#name":[{"@value":"rbs"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"rbs_gfp"}],"http://sbols.org/v3#description":[{"@value":"RBS"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000020"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent9"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent8","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/IPTG_LacI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent8"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/IPTG_LacI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000253"}],"http://sbols.org/v3#name":[{"@value":"IPTG_LacI"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"IPTG_LacI"}],"http://sbols.org/v3#description":[{"@value":"IPTG_LacI complex"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/rbs_tetR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000139"}],"http://sbols.org/v3#name":[{"@value":"rbs"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"rbs_tetR"}],"http://sbols.org/v3#description":[{"@value":"tetR RBS"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000177"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1"},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2"},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction3"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000010"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent6"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000010"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent7"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent8"}],"http://sbols.org/v3#displayId":[{"@value":"Participation3"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/ter_tetR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#name":[{"@value":"tetR terminator"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"ter_tetR"}],"http://sbols.org/v3#description":[{"@value":"Terminator"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/lacI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#name":[{"@value":"lacI"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"lacI"}],"http://sbols.org/v3#description":[{"@value":"lacI coding sequence"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent3","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/tetR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/tetR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#name":[{"@value":"tetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"tetR"}],"http://sbols.org/v3#description":[{"@value":"tetR coding sequence"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_protein","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#name":[{"@value":"TetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"TetR_protein"}],"http://sbols.org/v3#description":[{"@value":"TetR protein"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent8"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/toggle_switch","http://sbols.org/v3#displayId":[{"@value":"toggle_switch"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference1"},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference4"},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference3"},{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent2"},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference2"},{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent1"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#name":[{"@value":"Toggle Switch"}],"http://sbols.org/v3#hasConstraint":[{"@id":"https://sbolstandard.org/examples/toggle_switch/Constraint1"},{"@id":"https://sbolstandard.org/examples/toggle_switch/Constraint2"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#description":[{"@value":"Toggle Switch genetic circuit"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}]},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference4","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent5"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference4"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/TetR_producer"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/Constraint2","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference3"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#verifyIdentical"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference4"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint2"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000010"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent9"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent5","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/TetR_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent5"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent11"}],"http://sbols.org/v3#displayId":[{"@value":"Participation3"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000645"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000645"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent5"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent7","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/IPTG"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent7"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/IPTG","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000247"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/CHEBI:35224"}],"http://sbols.org/v3#name":[{"@value":"IPTG"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"IPTG"}],"http://sbols.org/v3#description":[{"@value":"IPTG"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction2","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000169"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1"},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction2"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000020"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent6"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/rbs_lacI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000139"}],"http://sbols.org/v3#name":[{"@value":"rbs"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"rbs_lacI"}],"http://sbols.org/v3#description":[{"@value":"RBS"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent2","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/rbs_tetR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000010"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent10"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/aTC","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000247"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/CHEBI:35224"}],"http://sbols.org/v3#name":[{"@value":"aTC"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"aTC"}],"http://sbols.org/v3#description":[{"@value":"aTC"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer","http://sbols.org/v3#hasInteraction":[{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction1"},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3"},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction2"}],"http://sbols.org/v3#description":[{"@value":"TetR producer"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent5"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent4"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent8"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent3"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent7"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent2"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent6"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"TetR_producer"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#name":[{"@value":"TetR device"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent4","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/ter_tetR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent4"}],"@type":["http://sbols.org/v3#SubComponent"]}]} \ No newline at end of file diff --git a/SBOL3/toggle_switch/toggle_switch.nt b/SBOL3/toggle_switch/toggle_switch.nt index 873c523..ed3c8a0 100644 --- a/SBOL3/toggle_switch/toggle_switch.nt +++ b/SBOL3/toggle_switch/toggle_switch.nt @@ -1,57 +1,67 @@ - . - . - "lacI" . - . - "lacI" . - "lacI coding sequence" . - . - . - "SubComponent6" . - . - . - . - "tetR terminator" . - . - "ter_tetR" . - "Terminator" . - . - . - "IPTG_LacI" . - . - "IPTG_LacI" . - "IPTG_LacI complex" . - . - . - . - . - "Constraint2" . - . - . - . - "lacI terminator" . - . - "ter_lacI" . - "Terminator" . - . . . "SubComponent6" . . - . - . - "IPTG" . - . - "IPTG" . - "IPTG" . - . - . - . - "Participation1" . - . - . - . - "Participation1" . - . + . + . + . + "Constraint1" . + . + . + "SubComponent6" . + . + . + . + . + . + . + "LacI producer" . + "LacI_producer" . + . + . + . + . + . + . + . + . + . + . + . + . + . + . + "LacI producer" . + . + . + . + "Interaction1" . + . + . + . + "gfp" . + . + "gfp" . + "gfp coding sequence" . + . + . + . + "ComponentReference3" . + . + . + "atC_TetR" . + . + "atC_TetR" . + "atC_TetR complex" . + . + . + . + "SubComponent1" . + . + . + . + "SubComponent1" . + . . . "pTetR" . @@ -59,13 +69,24 @@ "pTetR" . "TetR repressible promoter" . . - . - . - "LacI" . - . - "LacI_protein" . - "LacI protein" . - . + . + . + "Participation2" . + . + . + . + "Participation1" . + . + . + . + "Participation1" . + . + . + "GFP" . + . + "GFP_protein" . + "GFP" . + . . . "rbs" . @@ -73,59 +94,45 @@ "rbs_gfp" . "RBS" . . - . - "SubComponent5" . - . - . - "SubComponent11" . - . - . - . - . - . - "Interaction4" . - . - . - "atC_TetR" . - . - "atC_TetR" . - "atC_TetR complex" . - . - . - . - . - "Constraint1" . - . - . - . - "SubComponent5" . - . - . - . - "ComponentReference4" . - . - . - . - "SubComponent4" . - . + . + . + . + "Interaction3" . + . + . + "SubComponent8" . + . + . + "SubComponent8" . + . + . + . + "rbs" . + . + "rbs_tetR" . + "tetR RBS" . + . . . . . "Interaction3" . . - . - "SubComponent10" . - . - . - . - . - "Interaction3" . - . - . - . - "Participation3" . - . + . + . + "tetR terminator" . + . + "ter_tetR" . + "Terminator" . + . + . + . + "SubComponent3" . + . + . + . + "SubComponent3" . + . . . "TetR" . @@ -133,108 +140,186 @@ "TetR_protein" . "TetR protein" . . - . - . - . - . + . + . + "Participation2" . + . + . + . + "Participation1" . + . "toggle_switch" . - "Toggle Switch genetic circuit" . + . . + . + . + "Toggle Switch" . . + . . + . + "Toggle Switch genetic circuit" . . - . + . + . . - . - "Toggle Switch" . - . - . - . - "SubComponent4" . - . - . - . - "pLacI promoter" . - . - "pLacI" . - "LacI repressible promoter" . - . - . - . - "ComponentReference3" . - . - . - . - "rbs" . - . - "rbs_tetR" . - "tetR RBS" . - . - . - . - "gfp" . - . - "gfp" . - "gfp coding sequence" . - . - . - . - . - . - . - . - "LacI producer" . - "LacI_producer" . - . - . - . - . - . - . - . - . - . - "LacI producer" . - . - . - . - . - . - . - "SubComponent3" . - . - . - . - . - "Interaction2" . - . - . - . - "Participation2" . - . - . - "SubComponent2" . - . - . - . - "Participation2" . - . + . + . + "Participation1" . + . + . + "SubComponent11" . + . + . + "SubComponent1" . + . + . + . + "SubComponent5" . + . + . + "SubComponent5" . + . + . + . + "ComponentReference2" . + . + . + . + "Participation3" . + . + . + . + "LacI" . + . + "LacI_protein" . + "LacI protein" . + . + . + . + "Participation3" . + . + . + . + "lacI" . + . + "lacI" . + "lacI coding sequence" . + . + . + "IPTG_LacI" . + . + "IPTG_LacI" . + "IPTG_LacI complex" . + . + . + . + "Participation1" . + . + . + . + "Participation2" . + . . . . "Interaction2" . . + . + "SubComponent7" . + . + . + . + . + "Constraint2" . + . + . + "SubComponent7" . + . + . + . + . + "Interaction2" . + . + . + . + "ComponentReference4" . + . + . + . + "SubComponent2" . + . + . + . + "SubComponent2" . + . + . + . + "Participation1" . + . + . + . + "Participation2" . + . . . "Participation2" . . - . - . - "Participation2" . - . + . + . + "IPTG" . + . + "IPTG" . + "IPTG" . + . + . + . + "pLacI promoter" . + . + "pLacI" . + "LacI repressible promoter" . + . + . + . + . + . + "Interaction4" . + . + . + "SubComponent10" . + . . "SubComponent9" . . + . + "TetR producer" . + . + "TetR_producer" . + . + . + "TetR device" . + . + . + . + . + . + . + . + . + . + . + . + . + . + "aTC" . + . + "aTC" . + "aTC" . + . + . + . + "SubComponent4" . + . . . "rbs" . @@ -242,35 +327,10 @@ "rbs_lacI" . "RBS" . . - . - . - . - "TetR_producer" . - . - . - . - . - . - . - . - . - "TetR producer" . - . - . - "TetR device" . - . - . - . - . - "SubComponent3" . - . - . - "SubComponent8" . - . - . - . - "ComponentReference2" . - . + . + . + "SubComponent4" . + . . . "tetR" . @@ -278,94 +338,34 @@ "tetR" . "tetR coding sequence" . . - . - . - "Participation2" . - . - . - . - "SubComponent2" . - . - . - . - . - "Interaction1" . - . - . - . - . - "Interaction1" . - . - . - "SubComponent1" . - . - . - . - "Participation1" . - . - . - . - "Participation1" . - . - . - . - "Participation1" . - . - . - . - "Participation1" . - . - . - "SubComponent8" . - . - . - "GFP" . - . - "GFP_protein" . - "GFP" . - . - . - . - "SubComponent2" . - . - . - . - "Participation3" . - . - . - . - "aTC" . - . - "aTC" . - "aTC" . - . - . - "SubComponent7" . - . + . + . + "lacI terminator" . + . + "ter_lacI" . + "Terminator" . + . . . "ComponentReference1" . . - . - . - "Participation1" . - . - . - . - "SubComponent1" . - . - . - "SubComponent7" . - . - . - . - "SubComponent1" . - . - . - . - "Participation2" . - . . . "Participation2" . . + . + . + "Participation2" . + . + . + "SubComponent2" . + . + . + . + "Participation1" . + . + . + . + . + "Interaction1" . + . diff --git a/SBOL3/toggle_switch/toggle_switch.rdf b/SBOL3/toggle_switch/toggle_switch.rdf index 1d5ad3f..fde7fe0 100644 --- a/SBOL3/toggle_switch/toggle_switch.rdf +++ b/SBOL3/toggle_switch/toggle_switch.rdf @@ -10,21 +10,21 @@ xmlns="https://sbolstandard.org/examples/" xmlns:om="http://www.ontology-of-units-of-measure.org/resource/om-2/" xml:base="https://sbolstandard.org/examples/"> - + - - rbs + + lacI terminator - rbs_tetR - tetR RBS + ter_lacI + Terminator - + - - tetR + + rbs - tetR - tetR coding sequence + rbs_lacI + RBS @@ -34,118 +34,46 @@ IPTG IPTG - - - GFP - - GFP_protein - GFP - - - - - lacI terminator - - ter_lacI - Terminator - - - - - - SubComponent2 - - - - - - SubComponent7 - - - - - - - - SubComponent5 - - - TetR_producer - - - - - SubComponent3 - - - - - - - - SubComponent8 - - - - + + - - + + - + - + - SubComponent1 + SubComponent3 Participation1 - - + + - + - + - SubComponent6 + SubComponent5 Participation2 - Interaction2 - - - - - - - - - - - - - Participation1 - - - - - - - Participation2 - - Interaction1 TetR producer + + TetR_producer + @@ -155,13 +83,38 @@ SubComponent4 + TetR device + + + + + + SubComponent8 + + + + + + + + + SubComponent7 + + - + + + + + + SubComponent6 + + Participation1 @@ -182,25 +135,45 @@ Interaction3 - TetR device - - - - - - - rbs - - rbs_gfp - RBS - - - - - LacI - - LacI_protein - LacI protein + + + + + + + SubComponent2 + + + + + + + + + + + + + + + + SubComponent1 + + + Participation1 + + + + + + + Participation2 + + + Interaction2 + + + @@ -209,99 +182,27 @@ atC_TetR atC_TetR complex - - - - aTC + + + IPTG_LacI - aTC - aTC + IPTG_LacI + IPTG_LacI complex - - - - pTetR + + + GFP - pTetR - TetR repressible promoter + GFP_protein + GFP - + - - - - - - SubComponent1 - - + + pLacI promoter - - - - - - - SubComponent2 - - - ComponentReference4 - - - toggle_switch - Toggle Switch genetic circuit - - - - - - - - - SubComponent9 - - - - ComponentReference3 - - - - - - - - - - SubComponent7 - - - - ComponentReference1 - - - - - - - - ComponentReference2 - - - Constraint1 - - - - - - - - - Constraint2 - - - - Toggle Switch - + pLacI + LacI repressible promoter @@ -311,13 +212,21 @@ ter_tetR Terminator - + rbs - rbs_lacI - RBS + rbs_tetR + tetR RBS + + + + + TetR + + TetR_protein + TetR protein @@ -327,21 +236,37 @@ lacI lacI coding sequence - + - pLacI promoter + pTetR - pLacI - LacI repressible promoter + pTetR + TetR repressible promoter - - - - TetR + + + + rbs - TetR_protein - TetR protein + rbs_gfp + RBS + + + + + aTC + + aTC + aTC + + + + + gfp + + gfp + gfp coding sequence @@ -363,84 +288,104 @@ - + + + + SubComponent9 + + Participation2 Interaction3 - + - - - SubComponent11 + + + SubComponent10 - - + - + - SubComponent5 + SubComponent7 + + + LacI producer + LacI_producer + + + + + SubComponent3 - - + + - - - + + + Participation1 - + + + + Participation2 + + + + - - - SubComponent8 + + + SubComponent11 - Participation2 + Participation3 - Interaction2 + Interaction4 - LacI producer - LacI_producer - + - - - SubComponent10 + + + SubComponent8 + - + - - SubComponent2 + + SubComponent4 - + + + + + SubComponent5 + + + - - - - - SubComponent3 - - + Participation1 @@ -454,67 +399,122 @@ Interaction1 + + + + + + + SubComponent6 + + - - + + - - - + + + Participation1 - - - - Participation2 - - - - + - - Participation3 + + Participation2 - Interaction4 + Interaction2 - - - + - - SubComponent6 + + SubComponent2 - LacI producer + LacI producer + + + toggle_switch + + + + + + + SubComponent1 + + + ComponentReference1 + + - - - - - - SubComponent4 - + + + + + + SubComponent2 + + + ComponentReference4 + + + Toggle Switch + + + + + ComponentReference3 + + + + + + + + + + + ComponentReference2 + + + Constraint1 + + + + Toggle Switch genetic circuit + + + + + + + + + Constraint2 + + - + - gfp + tetR - gfp - gfp coding sequence + tetR + tetR coding sequence - - - IPTG_LacI + + + + LacI - IPTG_LacI - IPTG_LacI complex + LacI_protein + LacI protein diff --git a/SBOL3/toggle_switch/toggle_switch.rj b/SBOL3/toggle_switch/toggle_switch.rj index ebc4392..2176d08 100644 --- a/SBOL3/toggle_switch/toggle_switch.rj +++ b/SBOL3/toggle_switch/toggle_switch.rj @@ -1,359 +1,375 @@ { - "https://sbolstandard.org/examples/rbs_tetR" : { + "https://sbolstandard.org/examples/LacI_producer/SubComponent2" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "rbs_tetR" + "value" : "SubComponent2" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000139" + "value" : "https://sbolstandard.org/examples/rbs_lacI" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction4" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Interaction4" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://identifiers.org/SBO:0000177" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "rbs" + "http://sbols.org/v3#hasParticipation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "tetR RBS" + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Interaction" } ] } , - "https://sbolstandard.org/examples/LacI_producer/SubComponent4" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "SubComponent4" + "https://sbolstandard.org/examples/LacI_producer/SubComponent1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples/pTetR" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/rbs_gfp" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/LacI_producer/Interaction1" : { + "https://sbolstandard.org/examples/LacI_producer/Interaction2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interaction1" + "value" : "Interaction2" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000589" } ] , "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2" + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1" + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Interaction" - } - ] , - "http://sbols.org/v3#type" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000589" } ] } , - "https://sbolstandard.org/examples/LacI_producer/SubComponent8" : { + "https://sbolstandard.org/examples/LacI_producer/SubComponent4" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent8" + "value" : "SubComponent4" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/rbs_gfp" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/GFP_protein" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/toggle_switch/SubComponent1" : { + "https://sbolstandard.org/examples/LacI_producer/Interaction3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent1" + "value" : "Interaction3" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000169" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer" + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2" } - ] - } - , - "https://sbolstandard.org/examples/TetR_producer/SubComponent3" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "SubComponent3" + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "http://sbols.org/v3#Interaction" } - ] , + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent3" : { "http://sbols.org/v3#orientation" : [ { "type" : "uri" , "value" : "https://identifiers.org/SO:0001030" } ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent3" + } + ] , "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/tetR" + "value" : "https://sbolstandard.org/examples/lacI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1" : { - "http://sbols.org/v3#participant" : [ { + "https://sbolstandard.org/examples/atC_TetR" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "atC_TetR" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "Participation1" + "value" : "atC_TetR complex" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000642" + "value" : "https://identifiers.org/SBO:0000253" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "atC_TetR" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2" : { - "http://sbols.org/v3#participant" : [ { + "https://sbolstandard.org/examples/IPTG_LacI" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "IPTG_LacI" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent7" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "Participation2" + "value" : "IPTG_LacI complex" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000010" + "value" : "https://identifiers.org/SBO:0000253" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "IPTG_LacI" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/TetR_producer/SubComponent7" : { + "https://sbolstandard.org/examples/LacI_producer/Interaction1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent7" + "value" : "Interaction1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000589" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/IPTG" + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1" } - ] - } - , - "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" : { - "http://sbols.org/v3#participant" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11" + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2" } ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Interaction" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent9" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation3" + "value" : "SubComponent9" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000011" + "value" : "https://sbolstandard.org/examples/TetR_protein" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2" : { - "http://sbols.org/v3#participant" : [ { + "https://sbolstandard.org/examples/LacI_producer/SubComponent6" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent10" + "value" : "https://identifiers.org/SO:0001030" } ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation2" + "value" : "SubComponent6" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000010" + "value" : "https://sbolstandard.org/examples/ter_lacI" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/aTC" : { + "https://sbolstandard.org/examples/toggle_switch/Constraint2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "aTC" + "value" : "Constraint2" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "https://identifiers.org/CHEBI:35224" + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" - } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#restriction" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "aTC" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "aTC" + "value" : "http://sbols.org/v3#verifyIdentical" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#object" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000247" - } - ] - } - , - "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "ComponentReference4" + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" - } - ] , - "http://sbols.org/v3#inChildOf" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2" - } - ] , - "http://sbols.org/v3#refersTo" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + "value" : "http://sbols.org/v3#Constraint" } ] } , - "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2" : { - "http://sbols.org/v3#participant" : [ { + "https://sbolstandard.org/examples/LacI_producer/SubComponent5" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + "value" : "https://identifiers.org/SO:0001030" } ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation2" + "value" : "SubComponent5" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000020" + "value" : "https://sbolstandard.org/examples/gfp" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/lacI" : { + "https://sbolstandard.org/examples/pLacI" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "lacI" + "value" : "pLacI" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000316" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000167" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -361,291 +377,231 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "lacI" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "lacI coding sequence" + "value" : "LacI repressible promoter" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "pLacI promoter" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/TetR_producer/Interaction3" : { + "https://sbolstandard.org/examples/LacI_producer/SubComponent8" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interaction3" + "value" : "SubComponent8" } ] , - "http://sbols.org/v3#hasParticipation" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2" - } - , { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1" + "value" : "https://sbolstandard.org/examples/GFP_protein" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Interaction" - } - ] , - "http://sbols.org/v3#type" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000177" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/TetR_protein" : { + "https://sbolstandard.org/examples/toggle_switch/Constraint1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "TetR_protein" + "value" : "Constraint1" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#subject" : [ { "type" : "uri" , - "value" : "https://identifiers.org/GO:0003700" + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#restriction" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#verifyIdentical" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#object" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "TetR" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "TetR protein" + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Constraint" } ] } , - "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent1" - } - ] , + "https://sbolstandard.org/examples/LacI_producer/SubComponent7" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation1" + "value" : "SubComponent7" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000642" + "value" : "https://sbolstandard.org/examples/LacI_protein" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/IPTG_LacI" : { + "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "IPTG_LacI" + "value" : "ComponentReference3" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#inChildOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "IPTG_LacI" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "IPTG_LacI complex" + "value" : "http://sbols.org/v3#ComponentReference" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#refersTo" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000253" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" } ] } , - "https://sbolstandard.org/examples/tetR" : { + "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "tetR" + "value" : "ComponentReference4" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#inChildOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000316" + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" - } - ] , - "http://sbols.org/v3#hasNamespace" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "tetR" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "tetR coding sequence" + "value" : "http://sbols.org/v3#ComponentReference" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#refersTo" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" } ] } , - "https://sbolstandard.org/examples/LacI_producer/SubComponent7" : { + "https://sbolstandard.org/examples/TetR_protein" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent7" + "value" : "TetR_protein" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/GO:0003700" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_protein" - } - ] - } - , - "https://sbolstandard.org/examples/toggle_switch/Constraint1" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "Constraint1" + "value" : "https://sbolstandard.org/examples" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "TetR protein" } ] , - "http://sbols.org/v3#subject" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" + "value" : "https://identifiers.org/SBO:0000252" } ] , - "http://sbols.org/v3#restriction" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#verifyIdentical" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "TetR" } ] , - "http://sbols.org/v3#object" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/TetR_producer/SubComponent8" : { + "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent8" + "value" : "ComponentReference1" + } + ] , + "http://sbols.org/v3#inChildOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "http://sbols.org/v3#ComponentReference" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#refersTo" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/IPTG_LacI" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" } ] } , - "https://sbolstandard.org/examples/LacI_producer/Interaction2" : { + "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interaction2" + "value" : "ComponentReference2" } ] , - "http://sbols.org/v3#hasParticipation" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2" - } - , { + "http://sbols.org/v3#inChildOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1" + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Interaction" + "value" : "http://sbols.org/v3#ComponentReference" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#refersTo" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000589" + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" } ] } , - "https://sbolstandard.org/examples/TetR_producer" : { + "https://sbolstandard.org/examples/pTetR" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "TetR_producer" + "value" : "pTetR" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000704" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000167" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -653,111 +609,100 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#hasFeature" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent8" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent3" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent2" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent1" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent7" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "TetR repressible promoter" } - , { + ] , + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent4" + "value" : "https://identifiers.org/SBO:0000251" } ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "TetR device" + "value" : "pTetR" } ] , - "http://sbols.org/v3#hasInteraction" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction1" + "value" : "http://sbols.org/v3#Component" } - , { + ] + } + , + "https://sbolstandard.org/examples/rbs_gfp" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "rbs_gfp" + } + ] , + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction2" + "value" : "https://identifiers.org/SO:0000139" } - , { + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction3" + "value" : "https://sbolstandard.org/examples" } ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "TetR producer" + "value" : "RBS" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "rbs" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent8" - } - ] , + "https://sbolstandard.org/examples/aTC" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation3" + "value" : "aTC" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000011" + "value" : "https://identifiers.org/CHEBI:35224" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "https://sbolstandard.org/examples" } - ] - } - , - "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "ComponentReference3" + "value" : "aTC" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" + "value" : "https://identifiers.org/SBO:0000247" } ] , - "http://sbols.org/v3#inChildOf" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "aTC" } ] , - "http://sbols.org/v3#refersTo" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + "value" : "http://sbols.org/v3#Component" } ] } @@ -773,21 +718,11 @@ "value" : "https://identifiers.org/GO:0003700" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" - } - ] , "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "LacI" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , "value" : "LacI protein" @@ -796,65 +731,105 @@ "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "LacI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/LacI_producer/SubComponent3" : { + "https://sbolstandard.org/examples/rbs_lacI" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent3" + "value" : "rbs_lacI" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SO:0000139" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "RBS" + } + ] , + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/lacI" + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "rbs" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/TetR_producer/SubComponent4" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "SubComponent4" + "https://sbolstandard.org/examples/TetR_producer" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent7" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent8" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent3" } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + , { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent4" } - ] , - "http://sbols.org/v3#orientation" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent1" } - ] , - "http://sbols.org/v3#instanceOf" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ter_tetR" + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent2" } - ] - } - , - "https://sbolstandard.org/examples/atC_TetR" : { + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "atC_TetR" + "value" : "TetR_producer" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "TetR producer" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -862,125 +837,91 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "atC_TetR" + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "atC_TetR complex" + "http://sbols.org/v3#hasInteraction" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction2" } - ] , - "http://sbols.org/v3#type" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000253" + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction3" } - ] - } - , - "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1" : { - "http://sbols.org/v3#participant" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent3" + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction1" } ] , - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "Participation1" - } - ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000645" + "value" : "TetR device" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/ter_tetR" : { + "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ter_tetR" + "value" : "Participation1" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000141" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SBO:0000645" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "tetR terminator" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Terminator" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/TetR_producer/Interaction2" : { + "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interaction2" + "value" : "Participation2" } ] , - "http://sbols.org/v3#hasParticipation" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2" - } - , { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1" + "value" : "https://identifiers.org/SBO:0000011" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Interaction" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000169" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/rbs_lacI" : { + "https://sbolstandard.org/examples/lacI" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "rbs_lacI" + "value" : "lacI" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000139" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000316" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -988,37 +929,37 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "rbs" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "RBS" + "value" : "lacI coding sequence" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "lacI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/pLacI" : { + "https://sbolstandard.org/examples/gfp" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "pLacI" + "value" : "gfp" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000167" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000316" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -1026,51 +967,36 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "pLacI promoter" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "LacI repressible promoter" + "value" : "gfp coding sequence" } ] , "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" - } - ] - } - , - "https://sbolstandard.org/examples/LacI_producer" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "LacI_producer" } ] , - "http://sbols.org/v3#role" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0000704" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "gfp" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Component" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples" - } - ] , + ] + } + , + "https://sbolstandard.org/examples/LacI_producer" : { "http://sbols.org/v3#hasFeature" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent5" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent10" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" } , { "type" : "uri" , @@ -1078,11 +1004,11 @@ } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" } , { "type" : "uri" , @@ -1090,45 +1016,38 @@ } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent5" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent10" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent8" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" } , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "LacI producer" + "value" : "LacI_producer" } ] , - "http://sbols.org/v3#hasInteraction" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction2" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction1" - } - , { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction4" + "value" : "https://identifiers.org/SO:0000704" } - , { + ] , + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction3" + "value" : "https://sbolstandard.org/examples" } ] , "http://sbols.org/v3#description" : [ { @@ -1140,92 +1059,99 @@ "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" } - ] - } - , - "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2" : { - "http://sbols.org/v3#participant" : [ { + ] , + "http://sbols.org/v3#hasInteraction" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction4" } - ] , - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "Participation2" + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction2" } - ] , - "http://sbols.org/v3#role" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000011" + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction3" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction1" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "LacI producer" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/toggle_switch/Constraint2" : { + "https://sbolstandard.org/examples/LacI_producer/SubComponent10" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Constraint2" + "value" : "SubComponent10" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Constraint" + "value" : "https://sbolstandard.org/examples/aTC" } ] , - "http://sbols.org/v3#subject" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent11" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent11" } ] , - "http://sbols.org/v3#restriction" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#verifyIdentical" + "value" : "https://sbolstandard.org/examples/atC_TetR" } ] , - "http://sbols.org/v3#object" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/LacI_producer/SubComponent6" : { + "https://sbolstandard.org/examples/TetR_producer/SubComponent7" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent6" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "SubComponent7" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples/IPTG" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/ter_lacI" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/GFP_protein" : { + "https://sbolstandard.org/examples/ter_lacI" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "GFP_protein" + "value" : "ter_lacI" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://identifiers.org/SO:0000141" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -1233,222 +1159,251 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "GFP" + "value" : "Terminator" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "GFP" + "value" : "lacI terminator" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000252" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/LacI_producer/Interaction3" : { + "https://sbolstandard.org/examples/TetR_producer/SubComponent8" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interaction3" + "value" : "SubComponent8" } ] , - "http://sbols.org/v3#hasParticipation" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2" + "value" : "https://sbolstandard.org/examples/IPTG_LacI" } - , { + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1" + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/SubComponent5" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent5" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Interaction" + "value" : "https://sbolstandard.org/examples/TetR_protein" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000169" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/rbs_gfp" : { + "https://sbolstandard.org/examples/TetR_producer/SubComponent6" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "rbs_gfp" + "value" : "SubComponent6" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000139" + "value" : "https://sbolstandard.org/examples/LacI_protein" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#SubComponent" } - ] , - "http://sbols.org/v3#hasNamespace" : [ { + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/SubComponent3" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "rbs" + "value" : "SubComponent3" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "RBS" + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/tetR" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "ComponentReference2" + "https://sbolstandard.org/examples/TetR_producer/SubComponent4" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent4" } ] , - "http://sbols.org/v3#inChildOf" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + "value" : "https://sbolstandard.org/examples/ter_tetR" } ] , - "http://sbols.org/v3#refersTo" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + "value" : "http://sbols.org/v3#SubComponent" } ] } , "https://sbolstandard.org/examples/TetR_producer/SubComponent1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "SubComponent1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" - } - ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples/pLacI" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/pLacI" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1" : { - "http://sbols.org/v3#participant" : [ { + "https://sbolstandard.org/examples/TetR_producer/SubComponent2" : { + "http://sbols.org/v3#orientation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + "value" : "https://identifiers.org/SO:0001030" } ] , "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation1" + "value" : "SubComponent2" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000645" + "value" : "https://sbolstandard.org/examples/rbs_tetR" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/TetR_producer/SubComponent5" : { + "https://sbolstandard.org/examples/rbs_tetR" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent5" + "value" : "rbs_tetR" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SO:0000139" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_protein" + "value" : "https://sbolstandard.org/examples" } - ] - } - , - "https://sbolstandard.org/examples/LacI_producer/SubComponent2" : { - "http://sbols.org/v3#displayId" : [ { + ] , + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "tetR RBS" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000251" } ] , - "http://sbols.org/v3#orientation" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "rbs" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/rbs_lacI" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/LacI_producer/SubComponent11" : { + "https://sbolstandard.org/examples/tetR" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent11" + "value" : "tetR" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SO:0000316" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/atC_TetR" + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "tetR coding sequence" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "tetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" - } - ] , + "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "Participation2" @@ -1459,6 +1414,11 @@ "value" : "https://identifiers.org/SBO:0000011" } ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + } + ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Participation" @@ -1466,20 +1426,38 @@ ] } , - "https://sbolstandard.org/examples/pTetR" : { + "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "pTetR" + "value" : "Participation1" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000167" + "value" : "https://identifiers.org/SBO:0000645" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent5" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/IPTG" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "IPTG" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/CHEBI:35224" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -1487,194 +1465,207 @@ "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { + "http://sbols.org/v3#description" : [ { "type" : "literal" , - "value" : "pTetR" + "value" : "IPTG" } ] , - "http://sbols.org/v3#description" : [ { + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000247" + } + ] , + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "TetR repressible promoter" + "value" : "IPTG" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/TetR_producer/Interaction1" : { + "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Interaction1" + "value" : "Participation1" } ] , - "http://sbols.org/v3#hasParticipation" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" - } - , { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1" + "value" : "https://identifiers.org/SBO:0000010" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Interaction" + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000589" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/gfp" : { + "https://sbolstandard.org/examples/GFP_protein" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "gfp" + "value" : "GFP_protein" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0000316" + "value" : "https://sbolstandard.org/examples" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "GFP" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "https://identifiers.org/SBO:0000252" } ] , "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "gfp" - } - ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "gfp coding sequence" + "value" : "GFP" } ] , - "http://sbols.org/v3#type" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/LacI_producer/SubComponent5" : { + "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent5" + "value" : "Participation2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000010" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent7" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/gfp" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent5" - } - ] , + "https://sbolstandard.org/examples/TetR_producer/Interaction1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation1" + "value" : "Interaction1" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000645" + "value" : "https://identifiers.org/SBO:0000589" + } + ] , + "http://sbols.org/v3#hasParticipation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Interaction" } ] } , - "https://sbolstandard.org/examples/IPTG" : { + "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "IPTG" + "value" : "Participation3" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/CHEBI:35224" + "value" : "https://identifiers.org/SBO:0000011" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent8" } ] , - "http://sbols.org/v3#hasNamespace" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples" + "value" : "http://sbols.org/v3#Participation" } - ] , - "http://sbols.org/v3#name" : [ { + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2" : { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "IPTG" + "value" : "Participation2" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "IPTG" + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000020" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000247" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/LacI_producer/SubComponent9" : { + "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent9" + "value" : "Participation1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000642" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_protein" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/ter_lacI" : { + "https://sbolstandard.org/examples/ter_tetR" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ter_lacI" + "value" : "ter_tetR" } ] , "http://sbols.org/v3#role" : [ { @@ -1682,21 +1673,11 @@ "value" : "https://identifiers.org/SO:0000141" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" - } - ] , "http://sbols.org/v3#hasNamespace" : [ { "type" : "uri" , "value" : "https://sbolstandard.org/examples" } ] , - "http://sbols.org/v3#name" : [ { - "type" : "literal" , - "value" : "lacI terminator" - } - ] , "http://sbols.org/v3#description" : [ { "type" : "literal" , "value" : "Terminator" @@ -1705,65 +1686,21 @@ "http://sbols.org/v3#type" : [ { "type" : "uri" , "value" : "https://identifiers.org/SBO:0000251" - } - ] - } - , - "https://sbolstandard.org/examples/LacI_producer/Interaction4" : { - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "Interaction4" - } - ] , - "http://sbols.org/v3#hasParticipation" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1" - } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Interaction" } ] , - "http://sbols.org/v3#type" : [ { - "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000177" - } - ] - } - , - "https://sbolstandard.org/examples/toggle_switch/SubComponent2" : { - "http://sbols.org/v3#displayId" : [ { + "http://sbols.org/v3#name" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "tetR terminator" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" - } - ] , - "http://sbols.org/v3#instanceOf" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer" + "value" : "http://sbols.org/v3#Component" } ] } , - "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" - } - ] , + "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , "value" : "Participation2" @@ -1774,6 +1711,11 @@ "value" : "https://identifiers.org/SBO:0000011" } ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + } + ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , "value" : "http://sbols.org/v3#Participation" @@ -1781,153 +1723,142 @@ ] } , - "https://sbolstandard.org/examples/TetR_producer/SubComponent2" : { + "https://sbolstandard.org/examples/TetR_producer/Interaction2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent2" + "value" : "Interaction2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000169" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/rbs_tetR" + "value" : "http://sbols.org/v3#Interaction" } ] } , - "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" : { + "https://sbolstandard.org/examples/TetR_producer/Interaction3" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "ComponentReference1" - } - ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#ComponentReference" + "value" : "Interaction3" } ] , - "http://sbols.org/v3#inChildOf" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + "value" : "https://identifiers.org/SBO:0000177" } ] , - "http://sbols.org/v3#refersTo" : [ { + "http://sbols.org/v3#hasParticipation" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1" } - ] - } - , - "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1" : { - "http://sbols.org/v3#participant" : [ { + , { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" - } - ] , - "http://sbols.org/v3#displayId" : [ { - "type" : "literal" , - "value" : "Participation1" + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2" } - ] , - "http://sbols.org/v3#role" : [ { + , { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000010" + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#Interaction" } ] } , - "https://sbolstandard.org/examples/LacI_producer/SubComponent1" : { + "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent1" + "value" : "Participation1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000645" } ] , - "http://sbols.org/v3#orientation" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SO:0001030" + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent3" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/pTetR" + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/TetR_producer/SubComponent6" : { + "https://sbolstandard.org/examples/toggle_switch/SubComponent2" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent6" + "value" : "SubComponent2" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://sbolstandard.org/examples/TetR_producer" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_protein" + "value" : "http://sbols.org/v3#SubComponent" } ] } , - "https://sbolstandard.org/examples/LacI_producer/SubComponent10" : { + "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "SubComponent10" + "value" : "Participation1" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#SubComponent" + "value" : "https://identifiers.org/SBO:0000642" } ] , - "http://sbols.org/v3#instanceOf" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/aTC" + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1" : { - "http://sbols.org/v3#participant" : [ { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" - } - ] , + "https://sbolstandard.org/examples/toggle_switch/SubComponent1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation1" + "value" : "SubComponent1" } ] , - "http://sbols.org/v3#role" : [ { + "http://sbols.org/v3#instanceOf" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000010" + "value" : "https://sbolstandard.org/examples/LacI_producer" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "http://sbols.org/v3#Participation" + "value" : "http://sbols.org/v3#SubComponent" } ] } @@ -1938,14 +1869,39 @@ "value" : "toggle_switch" } ] , + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + } + ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , "value" : "https://identifiers.org/SO:0000704" } ] , - "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { - "type" : "uri" , - "value" : "http://sbols.org/v3#Component" + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Toggle Switch genetic circuit" } ] , "http://sbols.org/v3#hasNamespace" : [ { @@ -1962,62 +1918,106 @@ "value" : "https://sbolstandard.org/examples/toggle_switch/Constraint1" } ] , - "http://sbols.org/v3#hasFeature" : [ { + "http://sbols.org/v3#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" + "value" : "https://identifiers.org/SBO:0000251" } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Toggle Switch" } - , { + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + "value" : "http://sbols.org/v3#Component" } - , { - "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation3" } - , { + ] , + "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" + "value" : "https://identifiers.org/SBO:0000011" } - , { + ] , + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11" } ] , - "http://sbols.org/v3#name" : [ { + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2" : { + "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Toggle Switch" + "value" : "Participation2" } ] , - "http://sbols.org/v3#description" : [ { - "type" : "literal" , - "value" : "Toggle Switch genetic circuit" + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000020" } ] , - "http://sbols.org/v3#type" : [ { + "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000251" + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" } ] } , - "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2" : { + "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation2" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000010" + } + ] , "http://sbols.org/v3#participant" : [ { "type" : "uri" , - "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent10" } ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1" : { "http://sbols.org/v3#displayId" : [ { "type" : "literal" , - "value" : "Participation2" + "value" : "Participation1" } ] , "http://sbols.org/v3#role" : [ { "type" : "uri" , - "value" : "https://identifiers.org/SBO:0000020" + "value" : "https://identifiers.org/SBO:0000010" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" } ] , "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { diff --git a/SBOL3/toggle_switch/toggle_switch.ttl b/SBOL3/toggle_switch/toggle_switch.ttl index 09e55de..861cde1 100644 --- a/SBOL3/toggle_switch/toggle_switch.ttl +++ b/SBOL3/toggle_switch/toggle_switch.ttl @@ -1,464 +1,464 @@ -@base . -@prefix : . -@prefix CHEBI: . -@prefix EDAM: . -@prefix GO: . -@prefix SBO: . -@prefix SO: . -@prefix om: . -@prefix prov: . -@prefix sbol: . - -:lacI a sbol:Component ; - sbol:description "lacI coding sequence" ; - sbol:displayId "lacI" ; - sbol:hasNamespace ; - sbol:name "lacI" ; - sbol:role SO:0000316 ; - sbol:type SBO:0000251 . - - - a sbol:SubComponent ; - sbol:displayId "SubComponent6" ; - sbol:instanceOf :LacI_protein . - -:ter_tetR a sbol:Component ; - sbol:description "Terminator" ; - sbol:displayId "ter_tetR" ; - sbol:hasNamespace ; - sbol:name "tetR terminator" ; - sbol:role SO:0000141 ; - sbol:type SBO:0000251 . - -:IPTG_LacI a sbol:Component ; - sbol:description "IPTG_LacI complex" ; - sbol:displayId "IPTG_LacI" ; - sbol:hasNamespace ; - sbol:name "IPTG_LacI" ; - sbol:type SBO:0000253 . - - - a sbol:Constraint ; - sbol:displayId "Constraint2" ; - sbol:object ; - sbol:restriction sbol:verifyIdentical ; - sbol:subject . - -:ter_lacI a sbol:Component ; - sbol:description "Terminator" ; - sbol:displayId "ter_lacI" ; - sbol:hasNamespace ; - sbol:name "lacI terminator" ; - sbol:role SO:0000141 ; - sbol:type SBO:0000251 . +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: - a sbol:SubComponent ; - sbol:displayId "SubComponent6" ; - sbol:instanceOf :ter_lacI ; + a sbol:SubComponent; + sbol:displayId "SubComponent6"; + sbol:instanceOf :ter_lacI; sbol:orientation SO:0001030 . -:IPTG a sbol:Component ; - sbol:description "IPTG" ; - sbol:displayId "IPTG" ; - sbol:hasNamespace ; - sbol:name "IPTG" ; - sbol:role CHEBI:35224 ; - sbol:type SBO:0000247 . - - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000642 . + + a sbol:Constraint; + sbol:displayId "Constraint1"; + sbol:object ; + sbol:restriction sbol:verifyIdentical; + sbol:subject . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000010 . + + a sbol:SubComponent; + sbol:displayId "SubComponent6"; + sbol:instanceOf :LacI_protein . -:pTetR a sbol:Component ; - sbol:description "TetR repressible promoter" ; - sbol:displayId "pTetR" ; - sbol:hasNamespace ; - sbol:name "pTetR" ; - sbol:role SO:0000167 ; - sbol:type SBO:0000251 . +:LacI_producer a sbol:Component; + sbol:description "LacI producer"; + sbol:displayId "LacI_producer"; + sbol:hasFeature , , , , , , , , , , ; + sbol:hasInteraction , , , ; + sbol:hasNamespace ; + sbol:name "LacI producer"; + sbol:role SO:0000704; + sbol:type SBO:0000251 . -:LacI_protein a sbol:Component ; - sbol:description "LacI protein" ; - sbol:displayId "LacI_protein" ; - sbol:hasNamespace ; - sbol:name "LacI" ; - sbol:role GO:0003700 ; - sbol:type SBO:0000252 . + + a sbol:Interaction; + sbol:displayId "Interaction1"; + sbol:hasParticipation , ; + sbol:type SBO:0000589 . -:rbs_gfp a sbol:Component ; - sbol:description "RBS" ; - sbol:displayId "rbs_gfp" ; - sbol:hasNamespace ; - sbol:name "rbs" ; - sbol:role SO:0000139 ; +:gfp a sbol:Component; + sbol:description "gfp coding sequence"; + sbol:displayId "gfp"; + sbol:hasNamespace ; + sbol:name "gfp"; + sbol:role SO:0000316; sbol:type SBO:0000251 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent5" ; - sbol:instanceOf :TetR_protein . - - - a sbol:SubComponent ; - sbol:displayId "SubComponent11" ; - sbol:instanceOf :atC_TetR . - - - a sbol:Interaction ; - sbol:displayId "Interaction4" ; - sbol:hasParticipation , , ; - sbol:type SBO:0000177 . + + a sbol:ComponentReference; + sbol:displayId "ComponentReference3"; + sbol:inChildOf ; + sbol:refersTo . -:atC_TetR a sbol:Component ; - sbol:description "atC_TetR complex" ; - sbol:displayId "atC_TetR" ; - sbol:hasNamespace ; - sbol:name "atC_TetR" ; +:atC_TetR a sbol:Component; + sbol:description "atC_TetR complex"; + sbol:displayId "atC_TetR"; + sbol:hasNamespace ; + sbol:name "atC_TetR"; sbol:type SBO:0000253 . - - a sbol:Constraint ; - sbol:displayId "Constraint1" ; - sbol:object ; - sbol:restriction sbol:verifyIdentical ; - sbol:subject . - - - a sbol:SubComponent ; - sbol:displayId "SubComponent5" ; - sbol:instanceOf :gfp ; + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :pTetR; sbol:orientation SO:0001030 . - - a sbol:ComponentReference ; - sbol:displayId "ComponentReference4" ; - sbol:inChildOf ; - sbol:refersTo . - - - a sbol:SubComponent ; - sbol:displayId "SubComponent4" ; - sbol:instanceOf :ter_tetR ; + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :pLacI; sbol:orientation SO:0001030 . - - a sbol:Interaction ; - sbol:displayId "Interaction3" ; - sbol:hasParticipation , , ; - sbol:type SBO:0000177 . +:pTetR a sbol:Component; + sbol:description "TetR repressible promoter"; + sbol:displayId "pTetR"; + sbol:hasNamespace ; + sbol:name "pTetR"; + sbol:role SO:0000167; + sbol:type SBO:0000251 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent10" ; - sbol:instanceOf :aTC . + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000011 . - - a sbol:Interaction ; - sbol:displayId "Interaction3" ; - sbol:hasParticipation , ; - sbol:type SBO:0000169 . + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000642 . - - a sbol:Participation ; - sbol:displayId "Participation3" ; - sbol:participant ; - sbol:role SBO:0000011 . + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000642 . -:TetR_protein a sbol:Component ; - sbol:description "TetR protein" ; - sbol:displayId "TetR_protein" ; - sbol:hasNamespace ; - sbol:name "TetR" ; - sbol:role GO:0003700 ; +:GFP_protein a sbol:Component; + sbol:description "GFP"; + sbol:displayId "GFP_protein"; + sbol:hasNamespace ; + sbol:name "GFP"; sbol:type SBO:0000252 . -:toggle_switch a sbol:Component ; - sbol:description "Toggle Switch genetic circuit" ; - sbol:displayId "toggle_switch" ; - sbol:hasConstraint , ; - sbol:hasFeature , , , , , ; - sbol:hasNamespace ; - sbol:name "Toggle Switch" ; - sbol:role SO:0000704 ; - sbol:type SBO:0000251 . +:rbs_gfp a sbol:Component; + sbol:description "RBS"; + sbol:displayId "rbs_gfp"; + sbol:hasNamespace ; + sbol:name "rbs"; + sbol:role SO:0000139; + sbol:type SBO:0000251 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent4" ; - sbol:instanceOf :rbs_gfp ; - sbol:orientation SO:0001030 . + + a sbol:Interaction; + sbol:displayId "Interaction3"; + sbol:hasParticipation , ; + sbol:type SBO:0000169 . -:pLacI a sbol:Component ; - sbol:description "LacI repressible promoter" ; - sbol:displayId "pLacI" ; - sbol:hasNamespace ; - sbol:name "pLacI promoter" ; - sbol:role SO:0000167 ; - sbol:type SBO:0000251 . + + a sbol:SubComponent; + sbol:displayId "SubComponent8"; + sbol:instanceOf :GFP_protein . - - a sbol:ComponentReference ; - sbol:displayId "ComponentReference3" ; - sbol:inChildOf ; - sbol:refersTo . + + a sbol:SubComponent; + sbol:displayId "SubComponent8"; + sbol:instanceOf :IPTG_LacI . -:rbs_tetR a sbol:Component ; - sbol:description "tetR RBS" ; - sbol:displayId "rbs_tetR" ; - sbol:hasNamespace ; - sbol:name "rbs" ; - sbol:role SO:0000139 ; +:rbs_tetR a sbol:Component; + sbol:description "tetR RBS"; + sbol:displayId "rbs_tetR"; + sbol:hasNamespace ; + sbol:name "rbs"; + sbol:role SO:0000139; sbol:type SBO:0000251 . -:gfp a sbol:Component ; - sbol:description "gfp coding sequence" ; - sbol:displayId "gfp" ; - sbol:hasNamespace ; - sbol:name "gfp" ; - sbol:role SO:0000316 ; + + a sbol:Interaction; + sbol:displayId "Interaction3"; + sbol:hasParticipation , , ; + sbol:type SBO:0000177 . + +:ter_tetR a sbol:Component; + sbol:description "Terminator"; + sbol:displayId "ter_tetR"; + sbol:hasNamespace ; + sbol:name "tetR terminator"; + sbol:role SO:0000141; sbol:type SBO:0000251 . -:LacI_producer a sbol:Component ; - sbol:description "LacI producer" ; - sbol:displayId "LacI_producer" ; - sbol:hasFeature , , , , , , , , , , ; - sbol:hasInteraction , , , ; - sbol:hasNamespace ; - sbol:name "LacI producer" ; - sbol:role SO:0000704 ; - sbol:type SBO:0000251 . + + a sbol:SubComponent; + sbol:displayId "SubComponent3"; + sbol:instanceOf :lacI; + sbol:orientation SO:0001030 . - a sbol:SubComponent ; - sbol:displayId "SubComponent3" ; - sbol:instanceOf :tetR ; + a sbol:SubComponent; + sbol:displayId "SubComponent3"; + sbol:instanceOf :tetR; sbol:orientation SO:0001030 . - - a sbol:Interaction ; - sbol:displayId "Interaction2" ; - sbol:hasParticipation , ; - sbol:type SBO:0000169 . +:TetR_protein a sbol:Component; + sbol:description "TetR protein"; + sbol:displayId "TetR_protein"; + sbol:hasNamespace ; + sbol:name "TetR"; + sbol:role GO:0003700; + sbol:type SBO:0000252 . - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; - sbol:role SBO:0000011 . - - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :TetR_producer . - - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; sbol:role SBO:0000011 . - - a sbol:Interaction ; - sbol:displayId "Interaction2" ; - sbol:hasParticipation , ; - sbol:type SBO:0000589 . + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000010 . - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; - sbol:role SBO:0000020 . +:toggle_switch a sbol:Component; + sbol:description "Toggle Switch genetic circuit"; + sbol:displayId "toggle_switch"; + sbol:hasConstraint , ; + sbol:hasFeature , , , , , ; + sbol:hasNamespace ; + sbol:name "Toggle Switch"; + sbol:role SO:0000704; + sbol:type SBO:0000251 . - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; sbol:role SBO:0000010 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent9" ; - sbol:instanceOf :TetR_protein . - -:rbs_lacI a sbol:Component ; - sbol:description "RBS" ; - sbol:displayId "rbs_lacI" ; - sbol:hasNamespace ; - sbol:name "rbs" ; - sbol:role SO:0000139 ; - sbol:type SBO:0000251 . + + a sbol:SubComponent; + sbol:displayId "SubComponent11"; + sbol:instanceOf :atC_TetR . -:TetR_producer a sbol:Component ; - sbol:description "TetR producer" ; - sbol:displayId "TetR_producer" ; - sbol:hasFeature , , , , , , , ; - sbol:hasInteraction , , ; - sbol:hasNamespace ; - sbol:name "TetR device" ; - sbol:role SO:0000704 ; - sbol:type SBO:0000251 . + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :LacI_producer . - - a sbol:SubComponent ; - sbol:displayId "SubComponent3" ; - sbol:instanceOf :lacI ; + + a sbol:SubComponent; + sbol:displayId "SubComponent5"; + sbol:instanceOf :gfp; sbol:orientation SO:0001030 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent8" ; - sbol:instanceOf :IPTG_LacI . + + a sbol:SubComponent; + sbol:displayId "SubComponent5"; + sbol:instanceOf :TetR_protein . - a sbol:ComponentReference ; - sbol:displayId "ComponentReference2" ; - sbol:inChildOf ; + a sbol:ComponentReference; + sbol:displayId "ComponentReference2"; + sbol:inChildOf ; sbol:refersTo . -:tetR a sbol:Component ; - sbol:description "tetR coding sequence" ; - sbol:displayId "tetR" ; - sbol:hasNamespace ; - sbol:name "tetR" ; - sbol:role SO:0000316 ; - sbol:type SBO:0000251 . - - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; + + a sbol:Participation; + sbol:displayId "Participation3"; + sbol:participant ; sbol:role SBO:0000011 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :rbs_tetR ; - sbol:orientation SO:0001030 . +:LacI_protein a sbol:Component; + sbol:description "LacI protein"; + sbol:displayId "LacI_protein"; + sbol:hasNamespace ; + sbol:name "LacI"; + sbol:role GO:0003700; + sbol:type SBO:0000252 . - - a sbol:Interaction ; - sbol:displayId "Interaction1" ; - sbol:hasParticipation , ; - sbol:type SBO:0000589 . + + a sbol:Participation; + sbol:displayId "Participation3"; + sbol:participant ; + sbol:role SBO:0000011 . - - a sbol:Interaction ; - sbol:displayId "Interaction1" ; - sbol:hasParticipation , ; - sbol:type SBO:0000589 . +:lacI a sbol:Component; + sbol:description "lacI coding sequence"; + sbol:displayId "lacI"; + sbol:hasNamespace ; + sbol:name "lacI"; + sbol:role SO:0000316; + sbol:type SBO:0000251 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :LacI_producer . +:IPTG_LacI a sbol:Component; + sbol:description "IPTG_LacI complex"; + sbol:displayId "IPTG_LacI"; + sbol:hasNamespace ; + sbol:name "IPTG_LacI"; + sbol:type SBO:0000253 . - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; sbol:role SBO:0000645 . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000645 . + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000011 . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000642 . + + a sbol:Interaction; + sbol:displayId "Interaction2"; + sbol:hasParticipation , ; + sbol:type SBO:0000589 . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000010 . + + a sbol:SubComponent; + sbol:displayId "SubComponent7"; + sbol:instanceOf :LacI_protein . - - a sbol:SubComponent ; - sbol:displayId "SubComponent8" ; - sbol:instanceOf :GFP_protein . + + a sbol:Constraint; + sbol:displayId "Constraint2"; + sbol:object ; + sbol:restriction sbol:verifyIdentical; + sbol:subject . -:GFP_protein a sbol:Component ; - sbol:description "GFP" ; - sbol:displayId "GFP_protein" ; - sbol:hasNamespace ; - sbol:name "GFP" ; - sbol:type SBO:0000252 . + + a sbol:SubComponent; + sbol:displayId "SubComponent7"; + sbol:instanceOf :IPTG . + + + a sbol:Interaction; + sbol:displayId "Interaction2"; + sbol:hasParticipation , ; + sbol:type SBO:0000169 . + + + a sbol:ComponentReference; + sbol:displayId "ComponentReference4"; + sbol:inChildOf ; + sbol:refersTo . - a sbol:SubComponent ; - sbol:displayId "SubComponent2" ; - sbol:instanceOf :rbs_lacI ; + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :rbs_lacI; sbol:orientation SO:0001030 . - - a sbol:Participation ; - sbol:displayId "Participation3" ; - sbol:participant ; - sbol:role SBO:0000011 . + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :rbs_tetR; + sbol:orientation SO:0001030 . -:aTC a sbol:Component ; - sbol:description "aTC" ; - sbol:displayId "aTC" ; - sbol:hasNamespace ; - sbol:name "aTC" ; - sbol:role CHEBI:35224 ; + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000645 . + + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000020 . + + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000020 . + +:IPTG a sbol:Component; + sbol:description "IPTG"; + sbol:displayId "IPTG"; + sbol:hasNamespace ; + sbol:name "IPTG"; + sbol:role CHEBI:35224; sbol:type SBO:0000247 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent7" ; - sbol:instanceOf :IPTG . +:pLacI a sbol:Component; + sbol:description "LacI repressible promoter"; + sbol:displayId "pLacI"; + sbol:hasNamespace ; + sbol:name "pLacI promoter"; + sbol:role SO:0000167; + sbol:type SBO:0000251 . - - a sbol:ComponentReference ; - sbol:displayId "ComponentReference1" ; - sbol:inChildOf ; - sbol:refersTo . + + a sbol:Interaction; + sbol:displayId "Interaction4"; + sbol:hasParticipation , , ; + sbol:type SBO:0000177 . - - a sbol:Participation ; - sbol:displayId "Participation1" ; - sbol:participant ; - sbol:role SBO:0000645 . + + a sbol:SubComponent; + sbol:displayId "SubComponent10"; + sbol:instanceOf :aTC . - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :pLacI ; + + a sbol:SubComponent; + sbol:displayId "SubComponent9"; + sbol:instanceOf :TetR_protein . + +:TetR_producer a sbol:Component; + sbol:description "TetR producer"; + sbol:displayId "TetR_producer"; + sbol:hasFeature , , , , , , , ; + sbol:hasInteraction , , ; + sbol:hasNamespace ; + sbol:name "TetR device"; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + +:aTC a sbol:Component; + sbol:description "aTC"; + sbol:displayId "aTC"; + sbol:hasNamespace ; + sbol:name "aTC"; + sbol:role CHEBI:35224; + sbol:type SBO:0000247 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent4"; + sbol:instanceOf :rbs_gfp; sbol:orientation SO:0001030 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent7" ; - sbol:instanceOf :LacI_protein . +:rbs_lacI a sbol:Component; + sbol:description "RBS"; + sbol:displayId "rbs_lacI"; + sbol:hasNamespace ; + sbol:name "rbs"; + sbol:role SO:0000139; + sbol:type SBO:0000251 . - - a sbol:SubComponent ; - sbol:displayId "SubComponent1" ; - sbol:instanceOf :pTetR ; + + a sbol:SubComponent; + sbol:displayId "SubComponent4"; + sbol:instanceOf :ter_tetR; sbol:orientation SO:0001030 . - - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; - sbol:role SBO:0000020 . +:tetR a sbol:Component; + sbol:description "tetR coding sequence"; + sbol:displayId "tetR"; + sbol:hasNamespace ; + sbol:name "tetR"; + sbol:role SO:0000316; + sbol:type SBO:0000251 . + +:ter_lacI a sbol:Component; + sbol:description "Terminator"; + sbol:displayId "ter_lacI"; + sbol:hasNamespace ; + sbol:name "lacI terminator"; + sbol:role SO:0000141; + sbol:type SBO:0000251 . + + + a sbol:ComponentReference; + sbol:displayId "ComponentReference1"; + sbol:inChildOf ; + sbol:refersTo . - a sbol:Participation ; - sbol:displayId "Participation2" ; - sbol:participant ; + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000010 . + + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; sbol:role SBO:0000010 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :TetR_producer . + + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000645 . + + + a sbol:Interaction; + sbol:displayId "Interaction1"; + sbol:hasParticipation , ; + sbol:type SBO:0000589 . diff --git a/SBOL3/toggle_switch_v2/toggle_switch_v2.jsonld b/SBOL3/toggle_switch_v2/toggle_switch_v2.jsonld new file mode 100644 index 0000000..781f8ac --- /dev/null +++ b/SBOL3/toggle_switch_v2/toggle_switch_v2.jsonld @@ -0,0 +1,1091 @@ +{ + "@graph": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent6", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ter_lacI" + }, + "sbol:displayId": "SubComponent6", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/ter_lacI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "lacI terminator", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "ter_lacI", + "sbol:description": "Terminator", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint1", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" + }, + "sbol:restriction": { + "@id": "sbol:verifyIdentical" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + }, + "sbol:displayId": "Constraint1", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference1", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent3" + }, + "sbol:displayId": "ComponentReference1", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/molecule1" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LacI_protein" + }, + "sbol:displayId": "SubComponent6", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_protein", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:name": "LacI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "LacI_protein", + "sbol:description": "LacI protein", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer", + "sbol:hasInteraction": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2" + } + ], + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent10" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent11" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent4" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent5" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent6" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2" + } + ], + "@type": "sbol:Component", + "sbol:name": "LacI producer", + "sbol:displayId": "LacI_producer", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:description": "LacI producer" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3", + "sbol:type": { + "@id": "SBO:0000169" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2" + } + ], + "sbol:displayId": "Interaction3", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent10", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/aTC" + }, + "sbol:displayId": "SubComponent10", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LacI_protein" + }, + "sbol:displayId": "SubComponent7", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/lacI" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4", + "sbol:type": { + "@id": "SBO:0000177" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" + } + ], + "sbol:displayId": "Interaction4", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent11", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/atC_TetR" + }, + "sbol:displayId": "SubComponent11", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent8", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/GFP_protein" + }, + "sbol:displayId": "SubComponent8", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/TetR_protein" + }, + "sbol:displayId": "SubComponent9", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent4", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_gfp" + }, + "sbol:displayId": "SubComponent4", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent5", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/gfp" + }, + "sbol:displayId": "SubComponent5", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2" + } + ], + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/pTetR" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2" + } + ], + "sbol:displayId": "Interaction2", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent2", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_lacI" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1", + "sbol:type": { + "@id": "SBO:0000589" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" + } + ], + "sbol:displayId": "Interaction1", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1", + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent3" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/gfp", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:name": "gfp", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "gfp", + "sbol:description": "gfp coding sequence", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference3", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent3" + }, + "sbol:displayId": "ComponentReference3", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent3", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/LacI_producer" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/atC_TetR", + "sbol:type": { + "@id": "SBO:0000253" + }, + "sbol:name": "atC_TetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "atC_TetR", + "sbol:description": "atC_TetR complex", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/pTetR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:name": "pTetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "pTetR", + "sbol:description": "TetR repressible promoter", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent1", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/pLacI" + }, + "sbol:displayId": "SubComponent1", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/pLacI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000167" + }, + "sbol:name": "pLacI promoter", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "pLacI", + "sbol:description": "LacI repressible promoter", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent4", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/TetR_producer" + }, + "sbol:displayId": "SubComponent4", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer", + "sbol:hasInteraction": [ + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction1" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2" + } + ], + "sbol:description": "TetR producer", + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent4" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent8" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent3" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent7" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent1" + } + ], + "sbol:displayId": "TetR_producer", + "sbol:role": { + "@id": "SO:0000704" + }, + "sbol:name": "TetR device", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1", + "sbol:role": { + "@id": "SBO:0000642" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent1" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/molecule2", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:name": "Signalling Molecule 2", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "molecule2", + "sbol:description": "Signalling Molecule 2", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1", + "sbol:role": { + "@id": "SBO:0000642" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/GFP_protein", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:name": "GFP", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "GFP_protein", + "sbol:description": "GFP", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/rbs_gfp", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000139" + }, + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "rbs_gfp", + "sbol:description": "RBS", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2", + "sbol:role": { + "@id": "SBO:0000020" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint3", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" + }, + "sbol:restriction": { + "@id": "sbol:verifyIdentical" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + }, + "sbol:displayId": "Constraint3", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/molecule2" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent8", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/IPTG_LacI" + }, + "sbol:displayId": "SubComponent8", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/IPTG_LacI", + "sbol:type": { + "@id": "SBO:0000253" + }, + "sbol:name": "IPTG_LacI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "IPTG_LacI", + "sbol:description": "IPTG_LacI complex", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/rbs_tetR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000139" + }, + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "rbs_tetR", + "sbol:description": "tetR RBS", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3", + "sbol:type": { + "@id": "SBO:0000177" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3" + } + ], + "sbol:displayId": "Interaction3", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1", + "sbol:role": { + "@id": "SBO:0000010" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2", + "sbol:role": { + "@id": "SBO:0000010" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent7" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent8" + }, + "sbol:displayId": "Participation3", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/ter_tetR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000141" + }, + "sbol:name": "tetR terminator", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "ter_tetR", + "sbol:description": "Terminator", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/lacI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:name": "lacI", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "lacI", + "sbol:description": "lacI coding sequence", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent3", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/tetR" + }, + "sbol:displayId": "SubComponent3", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/tetR", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000316" + }, + "sbol:name": "tetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "tetR", + "sbol:description": "tetR coding sequence", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_protein", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:name": "TetR", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "TetR_protein", + "sbol:description": "TetR protein", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch", + "sbol:displayId": "toggle_switch", + "sbol:hasFeature": [ + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent3" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent4" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + } + ], + "sbol:hasConstraint": [ + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint3" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint4" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint1" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint2" + } + ], + "sbol:role": { + "@id": "SO:0000704" + }, + "@type": "sbol:Component", + "sbol:name": "Toggle Switch", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:description": "Toggle Switch genetic circuit", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + } + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference4", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent4" + }, + "sbol:displayId": "ComponentReference4", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint4", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" + }, + "sbol:restriction": { + "@id": "sbol:verifyIdentical" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + }, + "sbol:displayId": "Constraint4", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference2", + "sbol:refersTo": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + }, + "sbol:inChildOf": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent4" + }, + "sbol:displayId": "ComponentReference2", + "@type": "sbol:ComponentReference" + }, + { + "@id": "https://sbolstandard.org/examples/toggle_switch/Constraint2", + "sbol:subject": { + "@id": "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" + }, + "sbol:restriction": { + "@id": "sbol:verifyIdentical" + }, + "sbol:object": { + "@id": "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + }, + "sbol:displayId": "Constraint2", + "@type": "sbol:Constraint" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1", + "sbol:role": { + "@id": "SBO:0000010" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/molecule1", + "sbol:type": { + "@id": "SBO:0000252" + }, + "sbol:role": { + "@id": "GO:0003700" + }, + "sbol:name": "Signalling Molecule 1", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "molecule1", + "sbol:description": "Signalling Molecule 1", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent5", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/TetR_protein" + }, + "sbol:displayId": "SubComponent5", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3", + "sbol:role": { + "@id": "SBO:0000011" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent11" + }, + "sbol:displayId": "Participation3", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1", + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1", + "sbol:role": { + "@id": "SBO:0000645" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent5" + }, + "sbol:displayId": "Participation1", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent7", + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/IPTG" + }, + "sbol:displayId": "SubComponent7", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/IPTG", + "sbol:type": { + "@id": "SBO:0000247" + }, + "sbol:role": { + "@id": "CHEBI:35224" + }, + "sbol:name": "IPTG", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "IPTG", + "sbol:description": "IPTG", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2", + "sbol:type": { + "@id": "SBO:0000169" + }, + "sbol:hasParticipation": [ + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2" + } + ], + "sbol:displayId": "Interaction2", + "@type": "sbol:Interaction" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2", + "sbol:role": { + "@id": "SBO:0000020" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/rbs_lacI", + "sbol:type": { + "@id": "SBO:0000251" + }, + "sbol:role": { + "@id": "SO:0000139" + }, + "sbol:name": "rbs", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "rbs_lacI", + "sbol:description": "RBS", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent2", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/rbs_tetR" + }, + "sbol:displayId": "SubComponent2", + "@type": "sbol:SubComponent" + }, + { + "@id": "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2", + "sbol:role": { + "@id": "SBO:0000010" + }, + "sbol:participant": { + "@id": "https://sbolstandard.org/examples/LacI_producer/SubComponent10" + }, + "sbol:displayId": "Participation2", + "@type": "sbol:Participation" + }, + { + "@id": "https://sbolstandard.org/examples/aTC", + "sbol:type": { + "@id": "SBO:0000247" + }, + "sbol:role": { + "@id": "CHEBI:35224" + }, + "sbol:name": "aTC", + "sbol:hasNamespace": { + "@id": "https://sbolstandard.org/examples" + }, + "sbol:displayId": "aTC", + "sbol:description": "aTC", + "@type": "sbol:Component" + }, + { + "@id": "https://sbolstandard.org/examples/TetR_producer/SubComponent4", + "sbol:orientation": { + "@id": "SO:0001030" + }, + "sbol:instanceOf": { + "@id": "https://sbolstandard.org/examples/ter_tetR" + }, + "sbol:displayId": "SubComponent4", + "@type": "sbol:SubComponent" + } + ], + "@context": { + "SBO": "https://identifiers.org/SBO:", + "CHEBI": "https://identifiers.org/CHEBI:", + "GO": "https://identifiers.org/GO:", + "sbol": "http://sbols.org/v3#", + "EDAM": "https://identifiers.org/edam:", + "SO": "https://identifiers.org/SO:", + "prov": "http://www.w3.org/ns/prov#", + "om": "http://www.ontology-of-units-of-measure.org/resource/om-2/" + } +} diff --git a/SBOL3/toggle_switch_v2/toggle_switch_v2.jsonld_expanded b/SBOL3/toggle_switch_v2/toggle_switch_v2.jsonld_expanded new file mode 100644 index 0000000..dc2a04f --- /dev/null +++ b/SBOL3/toggle_switch_v2/toggle_switch_v2.jsonld_expanded @@ -0,0 +1 @@ +{"@graph":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent6","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/ter_lacI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent6"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/ter_lacI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#name":[{"@value":"lacI terminator"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"ter_lacI"}],"http://sbols.org/v3#description":[{"@value":"Terminator"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/Constraint1","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference1"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#verifyIdentical"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint1"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference1","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent7"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference1"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent1","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/molecule1"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent6","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/LacI_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent6"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_protein","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#name":[{"@value":"LacI"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"LacI_protein"}],"http://sbols.org/v3#description":[{"@value":"LacI protein"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/LacI_producer","http://sbols.org/v3#hasInteraction":[{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction3"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction2"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent10"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent7"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent3"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent11"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent8"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent9"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent4"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent5"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent6"},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent2"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#name":[{"@value":"LacI producer"}],"http://sbols.org/v3#displayId":[{"@value":"LacI_producer"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#description":[{"@value":"LacI producer"}]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction3","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000169"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction3"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent10","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/aTC"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent10"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent7","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/LacI_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent7"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent3","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/lacI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000177"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction4"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent11","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/atC_TetR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent11"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent8","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/GFP_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent8"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent9","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/TetR_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent9"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent4","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/rbs_gfp"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent4"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent5","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/gfp"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent5"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction1","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction1"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/pTetR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction2","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1"},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction2"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent2","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/rbs_lacI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction1","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000589"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1"},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction1"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000645"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent5"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/gfp","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#name":[{"@value":"gfp"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"gfp"}],"http://sbols.org/v3#description":[{"@value":"gfp coding sequence"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference3","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent9"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference3"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent3","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/LacI_producer"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/atC_TetR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000253"}],"http://sbols.org/v3#name":[{"@value":"atC_TetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"atC_TetR"}],"http://sbols.org/v3#description":[{"@value":"atC_TetR complex"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/pTetR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000167"}],"http://sbols.org/v3#name":[{"@value":"pTetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"pTetR"}],"http://sbols.org/v3#description":[{"@value":"TetR repressible promoter"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent1","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/pLacI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent1"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/pLacI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000167"}],"http://sbols.org/v3#name":[{"@value":"pLacI promoter"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"pLacI"}],"http://sbols.org/v3#description":[{"@value":"LacI repressible promoter"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent4","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/TetR_producer"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent4"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/TetR_producer","http://sbols.org/v3#hasInteraction":[{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction1"},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3"},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction2"}],"http://sbols.org/v3#description":[{"@value":"TetR producer"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent5"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent4"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent8"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent3"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent7"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent2"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent6"},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"TetR_producer"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"http://sbols.org/v3#name":[{"@value":"TetR device"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent7"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000642"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/molecule2","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#name":[{"@value":"Signalling Molecule 2"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"molecule2"}],"http://sbols.org/v3#description":[{"@value":"Signalling Molecule 2"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000642"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/GFP_protein","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#name":[{"@value":"GFP"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"GFP_protein"}],"http://sbols.org/v3#description":[{"@value":"GFP"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/rbs_gfp","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000139"}],"http://sbols.org/v3#name":[{"@value":"rbs"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"rbs_gfp"}],"http://sbols.org/v3#description":[{"@value":"RBS"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000020"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent9"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/Constraint3","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference3"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#verifyIdentical"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint3"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent2","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/molecule2"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent8","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/IPTG_LacI"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent8"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/IPTG_LacI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000253"}],"http://sbols.org/v3#name":[{"@value":"IPTG_LacI"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"IPTG_LacI"}],"http://sbols.org/v3#description":[{"@value":"IPTG_LacI complex"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/rbs_tetR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000139"}],"http://sbols.org/v3#name":[{"@value":"rbs"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"rbs_tetR"}],"http://sbols.org/v3#description":[{"@value":"tetR RBS"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000177"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1"},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2"},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction3"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000010"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent6"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000010"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent7"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent8"}],"http://sbols.org/v3#displayId":[{"@value":"Participation3"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/ter_tetR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000141"}],"http://sbols.org/v3#name":[{"@value":"tetR terminator"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"ter_tetR"}],"http://sbols.org/v3#description":[{"@value":"Terminator"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/lacI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#name":[{"@value":"lacI"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"lacI"}],"http://sbols.org/v3#description":[{"@value":"lacI coding sequence"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent3","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/tetR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent3"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/tetR","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000316"}],"http://sbols.org/v3#name":[{"@value":"tetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"tetR"}],"http://sbols.org/v3#description":[{"@value":"tetR coding sequence"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_protein","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#name":[{"@value":"TetR"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"TetR_protein"}],"http://sbols.org/v3#description":[{"@value":"TetR protein"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent8"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/toggle_switch","http://sbols.org/v3#displayId":[{"@value":"toggle_switch"}],"http://sbols.org/v3#hasFeature":[{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference1"},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference4"},{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent3"},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference3"},{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent2"},{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent4"},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference2"},{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent1"}],"http://sbols.org/v3#hasConstraint":[{"@id":"https://sbolstandard.org/examples/toggle_switch/Constraint3"},{"@id":"https://sbolstandard.org/examples/toggle_switch/Constraint4"},{"@id":"https://sbolstandard.org/examples/toggle_switch/Constraint1"},{"@id":"https://sbolstandard.org/examples/toggle_switch/Constraint2"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000704"}],"@type":["http://sbols.org/v3#Component"],"http://sbols.org/v3#name":[{"@value":"Toggle Switch"}],"http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#description":[{"@value":"Toggle Switch genetic circuit"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}]},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference4","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent5"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent4"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference4"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/Constraint4","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference4"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#verifyIdentical"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent2"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint4"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference2","http://sbols.org/v3#refersTo":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent6"}],"http://sbols.org/v3#inChildOf":[{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent4"}],"http://sbols.org/v3#displayId":[{"@value":"ComponentReference2"}],"@type":["http://sbols.org/v3#ComponentReference"]},{"@id":"https://sbolstandard.org/examples/toggle_switch/Constraint2","http://sbols.org/v3#subject":[{"@id":"https://sbolstandard.org/examples/toggle_switch/ComponentReference2"}],"http://sbols.org/v3#restriction":[{"@id":"http://sbols.org/v3#verifyIdentical"}],"http://sbols.org/v3#object":[{"@id":"https://sbolstandard.org/examples/toggle_switch/SubComponent1"}],"http://sbols.org/v3#displayId":[{"@value":"Constraint2"}],"@type":["http://sbols.org/v3#Constraint"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000010"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent9"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/molecule1","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000252"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/GO:0003700"}],"http://sbols.org/v3#name":[{"@value":"Signalling Molecule 1"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"molecule1"}],"http://sbols.org/v3#description":[{"@value":"Signalling Molecule 1"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent5","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/TetR_protein"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent5"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000011"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent11"}],"http://sbols.org/v3#displayId":[{"@value":"Participation3"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000645"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent3"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000645"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent5"}],"http://sbols.org/v3#displayId":[{"@value":"Participation1"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent7","http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/IPTG"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent7"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/IPTG","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000247"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/CHEBI:35224"}],"http://sbols.org/v3#name":[{"@value":"IPTG"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"IPTG"}],"http://sbols.org/v3#description":[{"@value":"IPTG"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction2","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000169"}],"http://sbols.org/v3#hasParticipation":[{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1"},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2"}],"http://sbols.org/v3#displayId":[{"@value":"Interaction2"}],"@type":["http://sbols.org/v3#Interaction"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000020"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent6"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/rbs_lacI","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000251"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SO:0000139"}],"http://sbols.org/v3#name":[{"@value":"rbs"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"rbs_lacI"}],"http://sbols.org/v3#description":[{"@value":"RBS"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent2","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/rbs_tetR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent2"}],"@type":["http://sbols.org/v3#SubComponent"]},{"@id":"https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2","http://sbols.org/v3#role":[{"@id":"https://identifiers.org/SBO:0000010"}],"http://sbols.org/v3#participant":[{"@id":"https://sbolstandard.org/examples/LacI_producer/SubComponent10"}],"http://sbols.org/v3#displayId":[{"@value":"Participation2"}],"@type":["http://sbols.org/v3#Participation"]},{"@id":"https://sbolstandard.org/examples/aTC","http://sbols.org/v3#type":[{"@id":"https://identifiers.org/SBO:0000247"}],"http://sbols.org/v3#role":[{"@id":"https://identifiers.org/CHEBI:35224"}],"http://sbols.org/v3#name":[{"@value":"aTC"}],"http://sbols.org/v3#hasNamespace":[{"@id":"https://sbolstandard.org/examples"}],"http://sbols.org/v3#displayId":[{"@value":"aTC"}],"http://sbols.org/v3#description":[{"@value":"aTC"}],"@type":["http://sbols.org/v3#Component"]},{"@id":"https://sbolstandard.org/examples/TetR_producer/SubComponent4","http://sbols.org/v3#orientation":[{"@id":"https://identifiers.org/SO:0001030"}],"http://sbols.org/v3#instanceOf":[{"@id":"https://sbolstandard.org/examples/ter_tetR"}],"http://sbols.org/v3#displayId":[{"@value":"SubComponent4"}],"@type":["http://sbols.org/v3#SubComponent"]}]} \ No newline at end of file diff --git a/SBOL3/toggle_switch_v2/toggle_switch_v2.nt b/SBOL3/toggle_switch_v2/toggle_switch_v2.nt new file mode 100644 index 0000000..d1112cb --- /dev/null +++ b/SBOL3/toggle_switch_v2/toggle_switch_v2.nt @@ -0,0 +1,405 @@ + . + . + "SubComponent6" . + . + . + . + . + "Constraint1" . + . + . + "SubComponent6" . + . + . + . + . + . + . + "LacI producer" . + "LacI_producer" . + . + . + . + . + . + . + . + . + . + . + . + . + . + . + "LacI producer" . + . + . + . + "Interaction1" . + . + . + . + "gfp" . + . + "gfp" . + "gfp coding sequence" . + . + . + . + "ComponentReference3" . + . + . + "atC_TetR" . + . + "atC_TetR" . + "atC_TetR complex" . + . + . + . + "SubComponent1" . + . + . + . + "SubComponent1" . + . + . + "SubComponent4" . + . + . + . + "pTetR" . + . + "pTetR" . + "TetR repressible promoter" . + . + . + . + "Participation2" . + . + . + . + "Participation1" . + . + . + . + "Signalling Molecule 2" . + . + "molecule2" . + "Signalling Molecule 2" . + . + . + . + "Participation1" . + . + . + "GFP" . + . + "GFP_protein" . + "GFP" . + . + . + . + "rbs" . + . + "rbs_gfp" . + "RBS" . + . + . + . + . + "Interaction3" . + . + . + "SubComponent8" . + . + . + . + . + "Constraint3" . + . + . + "SubComponent8" . + . + . + . + "rbs" . + . + "rbs_tetR" . + "tetR RBS" . + . + . + . + . + . + "Interaction3" . + . + . + . + "tetR terminator" . + . + "ter_tetR" . + "Terminator" . + . + . + . + "SubComponent3" . + . + . + . + "SubComponent3" . + . + . + . + "TetR" . + . + "TetR_protein" . + "TetR protein" . + . + . + . + "Participation2" . + . + . + . + "Participation1" . + . + "toggle_switch" . + . + . + . + . + . + . + . + "Toggle Switch" . + . + . + . + . + . + "Toggle Switch genetic circuit" . + . + . + . + . + . + . + "Participation1" . + . + . + "SubComponent11" . + . + . + "SubComponent1" . + . + . + . + "SubComponent5" . + . + . + "SubComponent5" . + . + . + . + "ComponentReference2" . + . + . + . + "Participation3" . + . + . + . + "LacI" . + . + "LacI_protein" . + "LacI protein" . + . + . + . + "Participation3" . + . + . + . + "lacI" . + . + "lacI" . + "lacI coding sequence" . + . + . + "IPTG_LacI" . + . + "IPTG_LacI" . + "IPTG_LacI complex" . + . + . + "SubComponent3" . + . + . + . + "Participation1" . + . + . + . + "Participation2" . + . + . + . + "Signalling Molecule 1" . + . + "molecule1" . + "Signalling Molecule 1" . + . + . + . + . + "Interaction2" . + . + . + "SubComponent7" . + . + . + . + . + "Constraint2" . + . + . + "SubComponent7" . + . + . + . + . + "Interaction2" . + . + . + . + "ComponentReference4" . + . + . + . + "SubComponent2" . + . + . + . + "SubComponent2" . + . + . + . + "Participation1" . + . + . + . + "Participation2" . + . + . + . + "Participation2" . + . + . + . + "IPTG" . + . + "IPTG" . + "IPTG" . + . + . + . + "pLacI promoter" . + . + "pLacI" . + "LacI repressible promoter" . + . + . + . + . + . + "Interaction4" . + . + . + "SubComponent10" . + . + . + "SubComponent9" . + . + . + "TetR producer" . + . + "TetR_producer" . + . + . + "TetR device" . + . + . + . + . + . + . + . + . + . + . + . + . + . + . + "Constraint4" . + . + . + . + "aTC" . + . + "aTC" . + "aTC" . + . + . + . + "SubComponent4" . + . + . + . + "rbs" . + . + "rbs_lacI" . + "RBS" . + . + . + . + "SubComponent4" . + . + . + . + "tetR" . + . + "tetR" . + "tetR coding sequence" . + . + . + . + "lacI terminator" . + . + "ter_lacI" . + "Terminator" . + . + . + . + "ComponentReference1" . + . + . + . + "Participation2" . + . + . + . + "Participation2" . + . + . + "SubComponent2" . + . + . + . + "Participation1" . + . + . + . + . + "Interaction1" . + . diff --git a/SBOL3/toggle_switch_v2/toggle_switch_v2.rdf b/SBOL3/toggle_switch_v2/toggle_switch_v2.rdf new file mode 100644 index 0000000..cfaf571 --- /dev/null +++ b/SBOL3/toggle_switch_v2/toggle_switch_v2.rdf @@ -0,0 +1,564 @@ + + + + + lacI terminator + + ter_lacI + Terminator + + + + + rbs + + rbs_lacI + RBS + + + + + IPTG + + IPTG + IPTG + + + + + + + + + + + + + + + SubComponent3 + + + Participation1 + + + + + + + + + + + SubComponent5 + + + Participation2 + + + Interaction1 + + + TetR producer + + TetR_producer + + + + + + + + SubComponent4 + + + TetR device + + + + + + SubComponent8 + + + + + + + + + SubComponent7 + + + + + + + + + + + + + + SubComponent6 + + + Participation1 + + + + + + + Participation2 + + + + + + + Participation3 + + + Interaction3 + + + + + + + + + SubComponent2 + + + + + + + + + + + + + + + + SubComponent1 + + + Participation1 + + + + + + + Participation2 + + + Interaction2 + + + + + + + atC_TetR + + atC_TetR + atC_TetR complex + + + + IPTG_LacI + + IPTG_LacI + IPTG_LacI complex + + + + GFP + + GFP_protein + GFP + + + + + pLacI promoter + + pLacI + LacI repressible promoter + + + + + tetR terminator + + ter_tetR + Terminator + + + + + rbs + + rbs_tetR + tetR RBS + + + + + TetR + + TetR_protein + TetR protein + + + + + lacI + + lacI + lacI coding sequence + + + + + pTetR + + pTetR + TetR repressible promoter + + + + + rbs + + rbs_gfp + RBS + + + + + aTC + + aTC + aTC + + + + + gfp + + gfp + gfp coding sequence + + + + + Signalling Molecule 1 + + molecule1 + Signalling Molecule 1 + + + + + Signalling Molecule 2 + + molecule2 + Signalling Molecule 2 + + + + + + + + + + + + + SubComponent1 + + + Participation1 + + + + + + + + + SubComponent9 + + + Participation2 + + + Interaction3 + + + + + + + SubComponent10 + + + + + + + + SubComponent7 + + + LacI producer + LacI_producer + + + + + SubComponent3 + + + + + + + + + + Participation1 + + + + + + + Participation2 + + + + + + + + + SubComponent11 + + + Participation3 + + + Interaction4 + + + + + + + SubComponent8 + + + + + + + + SubComponent4 + + + + + + + SubComponent5 + + + + + + + + + + + Participation1 + + + + + + + Participation2 + + + Interaction1 + + + + + + + + + SubComponent6 + + + + + + + + + + Participation1 + + + + + + + Participation2 + + + Interaction2 + + + + + + + SubComponent2 + + + LacI producer + + + toggle_switch + + + + + + + SubComponent3 + + + ComponentReference1 + + + + + + + + + ComponentReference3 + + + + + + + SubComponent2 + + + Constraint3 + + + + + + + + + + SubComponent4 + + + ComponentReference4 + + + + + + + + Constraint4 + + + + Toggle Switch + + + + + + + + + + + SubComponent1 + + + Constraint1 + + + + Toggle Switch genetic circuit + + + + + ComponentReference2 + + + + + + + + + + Constraint2 + + + + + + + tetR + + tetR + tetR coding sequence + + + + + LacI + + LacI_protein + LacI protein + + diff --git a/SBOL3/toggle_switch_v2/toggle_switch_v2.rj b/SBOL3/toggle_switch_v2/toggle_switch_v2.rj new file mode 100644 index 0000000..a044714 --- /dev/null +++ b/SBOL3/toggle_switch_v2/toggle_switch_v2.rj @@ -0,0 +1,2213 @@ +{ + "https://sbolstandard.org/examples/LacI_producer/SubComponent2" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent2" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/rbs_lacI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction4" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Interaction4" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000177" + } + ] , + "http://sbols.org/v3#hasParticipation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Interaction" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/pTetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Interaction2" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000589" + } + ] , + "http://sbols.org/v3#hasParticipation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Interaction" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent4" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent4" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/rbs_gfp" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction3" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Interaction3" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000169" + } + ] , + "http://sbols.org/v3#hasParticipation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Interaction" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent3" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent3" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/lacI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/atC_TetR" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "atC_TetR" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "atC_TetR complex" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000253" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "atC_TetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/IPTG_LacI" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "IPTG_LacI" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "IPTG_LacI complex" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000253" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "IPTG_LacI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Interaction1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000589" + } + ] , + "http://sbols.org/v3#hasParticipation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Interaction" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent9" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent9" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_protein" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent6" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent6" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/ter_lacI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch/Constraint2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Constraint2" + } + ] , + "http://sbols.org/v3#subject" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" + } + ] , + "http://sbols.org/v3#restriction" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#verifyIdentical" + } + ] , + "http://sbols.org/v3#object" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Constraint" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch/Constraint3" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Constraint3" + } + ] , + "http://sbols.org/v3#subject" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" + } + ] , + "http://sbols.org/v3#restriction" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#verifyIdentical" + } + ] , + "http://sbols.org/v3#object" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Constraint" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent5" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent5" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/gfp" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/pLacI" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "pLacI" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000167" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "LacI repressible promoter" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "pLacI promoter" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent8" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent8" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/GFP_protein" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch/Constraint1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Constraint1" + } + ] , + "http://sbols.org/v3#subject" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" + } + ] , + "http://sbols.org/v3#restriction" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#verifyIdentical" + } + ] , + "http://sbols.org/v3#object" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Constraint" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent7" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent7" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_protein" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ComponentReference3" + } + ] , + "http://sbols.org/v3#inChildOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent3" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#ComponentReference" + } + ] , + "http://sbols.org/v3#refersTo" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ComponentReference4" + } + ] , + "http://sbols.org/v3#inChildOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent4" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#ComponentReference" + } + ] , + "http://sbols.org/v3#refersTo" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_protein" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "TetR_protein" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/GO:0003700" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "TetR protein" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "TetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ComponentReference1" + } + ] , + "http://sbols.org/v3#inChildOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent3" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#ComponentReference" + } + ] , + "http://sbols.org/v3#refersTo" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ComponentReference2" + } + ] , + "http://sbols.org/v3#inChildOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent4" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#ComponentReference" + } + ] , + "http://sbols.org/v3#refersTo" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + } + ] + } + , + "https://sbolstandard.org/examples/pTetR" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "pTetR" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000167" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "TetR repressible promoter" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "pTetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/rbs_gfp" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "rbs_gfp" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000139" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "RBS" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "rbs" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/aTC" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "aTC" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/CHEBI:35224" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "aTC" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000247" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "aTC" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_protein" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "LacI_protein" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/GO:0003700" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "LacI protein" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "LacI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/rbs_lacI" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "rbs_lacI" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000139" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "RBS" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "rbs" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent7" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent8" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent3" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent4" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent2" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "TetR_producer" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "TetR producer" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#hasInteraction" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction3" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction1" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "TetR device" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000645" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction1/Participation2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation2" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000011" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/lacI" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "lacI" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000316" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "lacI coding sequence" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "lacI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch/Constraint4" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Constraint4" + } + ] , + "http://sbols.org/v3#subject" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" + } + ] , + "http://sbols.org/v3#restriction" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#verifyIdentical" + } + ] , + "http://sbols.org/v3#object" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Constraint" + } + ] + } + , + "https://sbolstandard.org/examples/gfp" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "gfp" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000316" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "gfp coding sequence" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "gfp" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer" : { + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent4" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent3" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent6" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent5" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent10" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent7" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "LacI_producer" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "LacI producer" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#hasInteraction" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction4" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction3" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/Interaction1" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "LacI producer" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent10" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent10" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/aTC" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/SubComponent11" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent11" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/atC_TetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/SubComponent7" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent7" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/IPTG" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/ter_lacI" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ter_lacI" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000141" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Terminator" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "lacI terminator" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/SubComponent8" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent8" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/IPTG_LacI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/SubComponent5" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent5" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_protein" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/SubComponent6" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent6" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_protein" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/SubComponent3" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent3" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/tetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/SubComponent4" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent4" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/ter_tetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/SubComponent1" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/pLacI" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch/SubComponent4" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent4" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/SubComponent2" : { + "http://sbols.org/v3#orientation" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0001030" + } + ] , + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent2" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/rbs_tetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/rbs_tetR" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "rbs_tetR" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000139" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "tetR RBS" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "rbs" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/tetR" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "tetR" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000316" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "tetR coding sequence" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "tetR" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation2" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000011" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent8" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction2/Participation1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000645" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent5" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/IPTG" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "IPTG" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/CHEBI:35224" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "IPTG" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000247" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "IPTG" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000010" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/GFP_protein" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "GFP_protein" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "GFP" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "GFP" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation2" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000010" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent7" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/Interaction1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Interaction1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000589" + } + ] , + "http://sbols.org/v3#hasParticipation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Interaction" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation3" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000011" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent8" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation2" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000020" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction3/Participation1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000642" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/ter_tetR" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "ter_tetR" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000141" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Terminator" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "tetR terminator" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation2" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000011" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent5" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/Interaction2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Interaction2" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000169" + } + ] , + "http://sbols.org/v3#hasParticipation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Interaction" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/Interaction3" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Interaction3" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000177" + } + ] , + "http://sbols.org/v3#hasParticipation" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/Interaction3/Participation3" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Interaction" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/Interaction1/Participation1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000645" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent3" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/molecule1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "molecule1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/GO:0003700" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Signalling Molecule 1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Signalling Molecule 1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/molecule2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "molecule2" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/GO:0003700" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Signalling Molecule 2" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000252" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Signalling Molecule 2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch/SubComponent2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent2" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/molecule2" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch/SubComponent3" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent3" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000642" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch/SubComponent1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "SubComponent1" + } + ] , + "http://sbols.org/v3#instanceOf" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/molecule1" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#SubComponent" + } + ] + } + , + "https://sbolstandard.org/examples/toggle_switch" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "toggle_switch" + } + ] , + "http://sbols.org/v3#hasFeature" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference3" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference4" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference1" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/ComponentReference2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent4" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent3" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/SubComponent1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SO:0000704" + } + ] , + "http://sbols.org/v3#description" : [ { + "type" : "literal" , + "value" : "Toggle Switch genetic circuit" + } + ] , + "http://sbols.org/v3#hasNamespace" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples" + } + ] , + "http://sbols.org/v3#hasConstraint" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/Constraint4" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/Constraint2" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/Constraint3" + } + , { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/toggle_switch/Constraint1" + } + ] , + "http://sbols.org/v3#type" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000251" + } + ] , + "http://sbols.org/v3#name" : [ { + "type" : "literal" , + "value" : "Toggle Switch" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Component" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation3" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation3" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000011" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent11" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/TetR_producer/Interaction2/Participation2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation2" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000020" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/TetR_producer/SubComponent6" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation2" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation2" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000010" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent10" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } + , + "https://sbolstandard.org/examples/LacI_producer/Interaction4/Participation1" : { + "http://sbols.org/v3#displayId" : [ { + "type" : "literal" , + "value" : "Participation1" + } + ] , + "http://sbols.org/v3#role" : [ { + "type" : "uri" , + "value" : "https://identifiers.org/SBO:0000010" + } + ] , + "http://sbols.org/v3#participant" : [ { + "type" : "uri" , + "value" : "https://sbolstandard.org/examples/LacI_producer/SubComponent9" + } + ] , + "http://www.w3.org/1999/02/22-rdf-syntax-ns#type" : [ { + "type" : "uri" , + "value" : "http://sbols.org/v3#Participation" + } + ] + } +} diff --git a/SBOL3/toggle_switch_v2/toggle_switch_v2.ttl b/SBOL3/toggle_switch_v2/toggle_switch_v2.ttl new file mode 100644 index 0000000..ca64d1f --- /dev/null +++ b/SBOL3/toggle_switch_v2/toggle_switch_v2.ttl @@ -0,0 +1,504 @@ +BASE +PREFIX : +PREFIX CHEBI: +PREFIX EDAM: +PREFIX GO: +PREFIX SBO: +PREFIX SO: +PREFIX om: +PREFIX prov: +PREFIX sbol: + + + a sbol:SubComponent; + sbol:displayId "SubComponent6"; + sbol:instanceOf :ter_lacI; + sbol:orientation SO:0001030 . + + + a sbol:Constraint; + sbol:displayId "Constraint1"; + sbol:object ; + sbol:restriction sbol:verifyIdentical; + sbol:subject . + + + a sbol:SubComponent; + sbol:displayId "SubComponent6"; + sbol:instanceOf :LacI_protein . + +:LacI_producer a sbol:Component; + sbol:description "LacI producer"; + sbol:displayId "LacI_producer"; + sbol:hasFeature , , , , , , , , , , ; + sbol:hasInteraction , , , ; + sbol:hasNamespace ; + sbol:name "LacI producer"; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + + + a sbol:Interaction; + sbol:displayId "Interaction1"; + sbol:hasParticipation , ; + sbol:type SBO:0000589 . + +:gfp a sbol:Component; + sbol:description "gfp coding sequence"; + sbol:displayId "gfp"; + sbol:hasNamespace ; + sbol:name "gfp"; + sbol:role SO:0000316; + sbol:type SBO:0000251 . + + + a sbol:ComponentReference; + sbol:displayId "ComponentReference3"; + sbol:inChildOf ; + sbol:refersTo . + +:atC_TetR a sbol:Component; + sbol:description "atC_TetR complex"; + sbol:displayId "atC_TetR"; + sbol:hasNamespace ; + sbol:name "atC_TetR"; + sbol:type SBO:0000253 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :pTetR; + sbol:orientation SO:0001030 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :pLacI; + sbol:orientation SO:0001030 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent4"; + sbol:instanceOf :TetR_producer . + +:pTetR a sbol:Component; + sbol:description "TetR repressible promoter"; + sbol:displayId "pTetR"; + sbol:hasNamespace ; + sbol:name "pTetR"; + sbol:role SO:0000167; + sbol:type SBO:0000251 . + + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000011 . + + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000642 . + +:molecule2 a sbol:Component; + sbol:description "Signalling Molecule 2"; + sbol:displayId "molecule2"; + sbol:hasNamespace ; + sbol:name "Signalling Molecule 2"; + sbol:role GO:0003700; + sbol:type SBO:0000252 . + + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000642 . + +:GFP_protein a sbol:Component; + sbol:description "GFP"; + sbol:displayId "GFP_protein"; + sbol:hasNamespace ; + sbol:name "GFP"; + sbol:type SBO:0000252 . + +:rbs_gfp a sbol:Component; + sbol:description "RBS"; + sbol:displayId "rbs_gfp"; + sbol:hasNamespace ; + sbol:name "rbs"; + sbol:role SO:0000139; + sbol:type SBO:0000251 . + + + a sbol:Interaction; + sbol:displayId "Interaction3"; + sbol:hasParticipation , ; + sbol:type SBO:0000169 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent8"; + sbol:instanceOf :GFP_protein . + + + a sbol:Constraint; + sbol:displayId "Constraint3"; + sbol:object ; + sbol:restriction sbol:verifyIdentical; + sbol:subject . + + + a sbol:SubComponent; + sbol:displayId "SubComponent8"; + sbol:instanceOf :IPTG_LacI . + +:rbs_tetR a sbol:Component; + sbol:description "tetR RBS"; + sbol:displayId "rbs_tetR"; + sbol:hasNamespace ; + sbol:name "rbs"; + sbol:role SO:0000139; + sbol:type SBO:0000251 . + + + a sbol:Interaction; + sbol:displayId "Interaction3"; + sbol:hasParticipation , , ; + sbol:type SBO:0000177 . + +:ter_tetR a sbol:Component; + sbol:description "Terminator"; + sbol:displayId "ter_tetR"; + sbol:hasNamespace ; + sbol:name "tetR terminator"; + sbol:role SO:0000141; + sbol:type SBO:0000251 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent3"; + sbol:instanceOf :lacI; + sbol:orientation SO:0001030 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent3"; + sbol:instanceOf :tetR; + sbol:orientation SO:0001030 . + +:TetR_protein a sbol:Component; + sbol:description "TetR protein"; + sbol:displayId "TetR_protein"; + sbol:hasNamespace ; + sbol:name "TetR"; + sbol:role GO:0003700; + sbol:type SBO:0000252 . + + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000011 . + + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000010 . + +:toggle_switch a sbol:Component; + sbol:description "Toggle Switch genetic circuit"; + sbol:displayId "toggle_switch"; + sbol:hasConstraint , , , ; + sbol:hasFeature , , , , , , , ; + sbol:hasNamespace ; + sbol:name "Toggle Switch"; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000010 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent11"; + sbol:instanceOf :atC_TetR . + + + a sbol:SubComponent; + sbol:displayId "SubComponent1"; + sbol:instanceOf :molecule1 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent5"; + sbol:instanceOf :gfp; + sbol:orientation SO:0001030 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent5"; + sbol:instanceOf :TetR_protein . + + + a sbol:ComponentReference; + sbol:displayId "ComponentReference2"; + sbol:inChildOf ; + sbol:refersTo . + + + a sbol:Participation; + sbol:displayId "Participation3"; + sbol:participant ; + sbol:role SBO:0000011 . + +:LacI_protein a sbol:Component; + sbol:description "LacI protein"; + sbol:displayId "LacI_protein"; + sbol:hasNamespace ; + sbol:name "LacI"; + sbol:role GO:0003700; + sbol:type SBO:0000252 . + + + a sbol:Participation; + sbol:displayId "Participation3"; + sbol:participant ; + sbol:role SBO:0000011 . + +:lacI a sbol:Component; + sbol:description "lacI coding sequence"; + sbol:displayId "lacI"; + sbol:hasNamespace ; + sbol:name "lacI"; + sbol:role SO:0000316; + sbol:type SBO:0000251 . + +:IPTG_LacI a sbol:Component; + sbol:description "IPTG_LacI complex"; + sbol:displayId "IPTG_LacI"; + sbol:hasNamespace ; + sbol:name "IPTG_LacI"; + sbol:type SBO:0000253 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent3"; + sbol:instanceOf :LacI_producer . + + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000645 . + + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000011 . + +:molecule1 a sbol:Component; + sbol:description "Signalling Molecule 1"; + sbol:displayId "molecule1"; + sbol:hasNamespace ; + sbol:name "Signalling Molecule 1"; + sbol:role GO:0003700; + sbol:type SBO:0000252 . + + + a sbol:Interaction; + sbol:displayId "Interaction2"; + sbol:hasParticipation , ; + sbol:type SBO:0000589 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent7"; + sbol:instanceOf :LacI_protein . + + + a sbol:Constraint; + sbol:displayId "Constraint2"; + sbol:object ; + sbol:restriction sbol:verifyIdentical; + sbol:subject . + + + a sbol:SubComponent; + sbol:displayId "SubComponent7"; + sbol:instanceOf :IPTG . + + + a sbol:Interaction; + sbol:displayId "Interaction2"; + sbol:hasParticipation , ; + sbol:type SBO:0000169 . + + + a sbol:ComponentReference; + sbol:displayId "ComponentReference4"; + sbol:inChildOf ; + sbol:refersTo . + + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :rbs_lacI; + sbol:orientation SO:0001030 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :rbs_tetR; + sbol:orientation SO:0001030 . + + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000645 . + + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000020 . + + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000020 . + +:IPTG a sbol:Component; + sbol:description "IPTG"; + sbol:displayId "IPTG"; + sbol:hasNamespace ; + sbol:name "IPTG"; + sbol:role CHEBI:35224; + sbol:type SBO:0000247 . + +:pLacI a sbol:Component; + sbol:description "LacI repressible promoter"; + sbol:displayId "pLacI"; + sbol:hasNamespace ; + sbol:name "pLacI promoter"; + sbol:role SO:0000167; + sbol:type SBO:0000251 . + + + a sbol:Interaction; + sbol:displayId "Interaction4"; + sbol:hasParticipation , , ; + sbol:type SBO:0000177 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent10"; + sbol:instanceOf :aTC . + + + a sbol:SubComponent; + sbol:displayId "SubComponent9"; + sbol:instanceOf :TetR_protein . + +:TetR_producer a sbol:Component; + sbol:description "TetR producer"; + sbol:displayId "TetR_producer"; + sbol:hasFeature , , , , , , , ; + sbol:hasInteraction , , ; + sbol:hasNamespace ; + sbol:name "TetR device"; + sbol:role SO:0000704; + sbol:type SBO:0000251 . + + + a sbol:Constraint; + sbol:displayId "Constraint4"; + sbol:object ; + sbol:restriction sbol:verifyIdentical; + sbol:subject . + +:aTC a sbol:Component; + sbol:description "aTC"; + sbol:displayId "aTC"; + sbol:hasNamespace ; + sbol:name "aTC"; + sbol:role CHEBI:35224; + sbol:type SBO:0000247 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent4"; + sbol:instanceOf :rbs_gfp; + sbol:orientation SO:0001030 . + +:rbs_lacI a sbol:Component; + sbol:description "RBS"; + sbol:displayId "rbs_lacI"; + sbol:hasNamespace ; + sbol:name "rbs"; + sbol:role SO:0000139; + sbol:type SBO:0000251 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent4"; + sbol:instanceOf :ter_tetR; + sbol:orientation SO:0001030 . + +:tetR a sbol:Component; + sbol:description "tetR coding sequence"; + sbol:displayId "tetR"; + sbol:hasNamespace ; + sbol:name "tetR"; + sbol:role SO:0000316; + sbol:type SBO:0000251 . + +:ter_lacI a sbol:Component; + sbol:description "Terminator"; + sbol:displayId "ter_lacI"; + sbol:hasNamespace ; + sbol:name "lacI terminator"; + sbol:role SO:0000141; + sbol:type SBO:0000251 . + + + a sbol:ComponentReference; + sbol:displayId "ComponentReference1"; + sbol:inChildOf ; + sbol:refersTo . + + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000010 . + + + a sbol:Participation; + sbol:displayId "Participation2"; + sbol:participant ; + sbol:role SBO:0000010 . + + + a sbol:SubComponent; + sbol:displayId "SubComponent2"; + sbol:instanceOf :molecule2 . + + + a sbol:Participation; + sbol:displayId "Participation1"; + sbol:participant ; + sbol:role SBO:0000645 . + + + a sbol:Interaction; + sbol:displayId "Interaction1"; + sbol:hasParticipation , ; + sbol:type SBO:0000589 . diff --git a/SBOL3/toggle_switch_v2/toggle_switch_v2_ordered.nt b/SBOL3/toggle_switch_v2/toggle_switch_v2_ordered.nt new file mode 100644 index 0000000..9b42fd1 --- /dev/null +++ b/SBOL3/toggle_switch_v2/toggle_switch_v2_ordered.nt @@ -0,0 +1,405 @@ + "GFP" . + "GFP_protein" . + . + "GFP" . + . + . + "IPTG" . + "IPTG" . + . + "IPTG" . + . + . + . + "IPTG_LacI complex" . + "IPTG_LacI" . + . + "IPTG_LacI" . + . + . + "Participation1" . + . + . + . + "Participation2" . + . + . + . + "Interaction1" . + . + . + . + . + "Participation1" . + . + . + . + "Participation2" . + . + . + . + "Interaction2" . + . + . + . + . + "Participation1" . + . + . + . + "Participation2" . + . + . + . + "Interaction3" . + . + . + . + . + "Participation1" . + . + . + . + "Participation2" . + . + . + . + "Participation3" . + . + . + . + "Interaction4" . + . + . + . + . + . + "SubComponent10" . + . + . + "SubComponent11" . + . + . + "SubComponent1" . + . + . + . + "SubComponent2" . + . + . + . + "SubComponent3" . + . + . + . + "SubComponent4" . + . + . + . + "SubComponent5" . + . + . + . + "SubComponent6" . + . + . + . + "SubComponent7" . + . + . + "SubComponent8" . + . + . + "SubComponent9" . + . + . + "LacI producer" . + "LacI_producer" . + . + . + . + . + . + . + . + . + . + . + . + . + . + . + . + . + "LacI producer" . + . + . + . + "LacI protein" . + "LacI_protein" . + . + "LacI" . + . + . + . + "Participation1" . + . + . + . + "Participation2" . + . + . + . + "Interaction1" . + . + . + . + . + "Participation1" . + . + . + . + "Participation2" . + . + . + . + "Interaction2" . + . + . + . + . + "Participation1" . + . + . + . + "Participation2" . + . + . + . + "Participation3" . + . + . + . + "Interaction3" . + . + . + . + . + . + "SubComponent1" . + . + . + . + "SubComponent2" . + . + . + . + "SubComponent3" . + . + . + . + "SubComponent4" . + . + . + . + "SubComponent5" . + . + . + "SubComponent6" . + . + . + "SubComponent7" . + . + . + "SubComponent8" . + . + . + "TetR producer" . + "TetR_producer" . + . + . + . + . + . + . + . + . + . + . + . + . + "TetR device" . + . + . + . + "TetR protein" . + "TetR_protein" . + . + "TetR" . + . + . + . + "aTC" . + "aTC" . + . + "aTC" . + . + . + . + "atC_TetR complex" . + "atC_TetR" . + . + "atC_TetR" . + . + . + "gfp coding sequence" . + "gfp" . + . + "gfp" . + . + . + . + "lacI coding sequence" . + "lacI" . + . + "lacI" . + . + . + . + "Signalling Molecule 1" . + "molecule1" . + . + "Signalling Molecule 1" . + . + . + . + "Signalling Molecule 2" . + "molecule2" . + . + "Signalling Molecule 2" . + . + . + . + "LacI repressible promoter" . + "pLacI" . + . + "pLacI promoter" . + . + . + . + "TetR repressible promoter" . + "pTetR" . + . + "pTetR" . + . + . + . + "RBS" . + "rbs_gfp" . + . + "rbs" . + . + . + . + "RBS" . + "rbs_lacI" . + . + "rbs" . + . + . + . + "tetR RBS" . + "rbs_tetR" . + . + "rbs" . + . + . + . + "Terminator" . + "ter_lacI" . + . + "lacI terminator" . + . + . + . + "Terminator" . + "ter_tetR" . + . + "tetR terminator" . + . + . + . + "tetR coding sequence" . + "tetR" . + . + "tetR" . + . + . + . + "ComponentReference1" . + . + . + . + "ComponentReference2" . + . + . + . + "ComponentReference3" . + . + . + . + "ComponentReference4" . + . + . + . + "Constraint1" . + . + . + . + . + "Constraint2" . + . + . + . + . + "Constraint3" . + . + . + . + . + "Constraint4" . + . + . + . + . + "SubComponent1" . + . + . + "SubComponent2" . + . + . + "SubComponent3" . + . + . + "SubComponent4" . + . + . + "Toggle Switch genetic circuit" . + "toggle_switch" . + . + . + . + . + . + . + . + . + . + . + . + . + . + "Toggle Switch" . + . + . + .